View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2145_high_8 (Length: 239)
Name: NF2145_high_8
Description: NF2145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2145_high_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 39 - 231
Target Start/End: Complemental strand, 4504302 - 4504109
Alignment:
| Q |
39 |
taaagaaaagttgcaactaagggaagagactctactgaatggaatctctaaagacattatctgaaaa-ttgaccaattaactgcttgtgttgtggggcca |
137 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
4504302 |
taaagaaaagttgcaactaagggaagagactctactgaatggaatctctaaagacattatctgaaaaattgaccaattaactgcttgtgttatggggcca |
4504203 |
T |
 |
| Q |
138 |
taagggtaactaacatacacatgacaatacattatgttccaacaaaaatggtcccatgaacattagccctagctcagatctcgtgattcatctc |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
4504202 |
taagggtaactaacatacacatgacaatacattatggtccaacaaaaatggtcccatgaacataagccctagctcagatctcgtgattaatctc |
4504109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University