View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2145_low_11 (Length: 236)
Name: NF2145_low_11
Description: NF2145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2145_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 19 - 220
Target Start/End: Complemental strand, 35915467 - 35915266
Alignment:
| Q |
19 |
ggtgttgtatattctaccatacgtttgtaaccgtcagcaccaaaattttaggagcaatatttagtagtgctatctatgtatgtactatgttgtgttgtgc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35915467 |
ggtgttgtatattctaccatacgtttgtaaccgtcagcaccaaaattttaggagcaatatttagtagtgctatctatgtatgtactatgttgtgttgtgc |
35915368 |
T |
 |
| Q |
119 |
ttgattgatgggtgcaactacattcgggtaaaatcttttctctgtgtaatnnnnnnngataaaacaacaacaatagggttttgtagctgatttagttgct |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
35915367 |
ttgattgatgggtgcaactacattcgggtaaaatcttttctttgtgtaataaaaaaagataaaataacaacaatagggttttgtagctgatttagttgct |
35915268 |
T |
 |
| Q |
219 |
tc |
220 |
Q |
| |
|
|| |
|
|
| T |
35915267 |
tc |
35915266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University