View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21461_low_10 (Length: 241)
Name: NF21461_low_10
Description: NF21461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21461_low_10 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 155; Significance: 2e-82; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 2125319 - 2125544
Alignment:
| Q |
1 |
atgttcatgtttctaaattgtggtctcaatataatagtttagaatttagaaccatacctaaccactaaaattttagtctaaatatttatatacaaagata |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
2125319 |
atgttcatgtttctaaattgtggtctcaatataatagtttagaatttagaaccatacttaaccactaaaattttagtataaatatttatataaaaagata |
2125418 |
T |
 |
| Q |
101 |
tgattagatgtttggcataaaacnnnnnnnnnnnnnnnnnggtactagagaggaccacatgcctaacttagtaactctacttgtacatagtaattgaatt |
200 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2125419 |
tgattagatgtttggcataaaaaaaatttgcaatttttttggtactagagaggaccacatgcctaacttagtaactctacttgtacatagtaattgaatt |
2125518 |
T |
 |
| Q |
201 |
ataagacttgtacatatgtccaattt |
226 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
2125519 |
ctaagacttgtacatatgtccaattt |
2125544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 179 - 219
Target Start/End: Complemental strand, 2245090 - 2245050
Alignment:
| Q |
179 |
acttgtacatagtaattgaattataagacttgtacatatgt |
219 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
2245090 |
acttgtacatagtaattgaattctaagacttgtacatatgt |
2245050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University