View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21462_high_18 (Length: 296)
Name: NF21462_high_18
Description: NF21462
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21462_high_18 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 188; Significance: 1e-102; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 77 - 289
Target Start/End: Original strand, 37191327 - 37191539
Alignment:
| Q |
77 |
aaggaattaatgttggataggttgaagcatatagatcaaatgactcagctagtcatggtcggtttggtattactccaagaactgctcccgttgtaagatg |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37191327 |
aaggaattaatgttggataggttgaagcatatagatcaaatgactcagctagtcatggtcggtttggtattactccaagaactgctcccgttgtaagatg |
37191426 |
T |
 |
| Q |
177 |
cttannnnnnngtcaccttttttatcatttacataagcttgttcatgttgggtatttgaattctctaccttatattgaagatgctaagttaagttatgta |
276 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37191427 |
cttatttttttgtcaccttttttatcatttacataagcttgttcatgttgggtatttgaattctctaccttatattgaagatgctaagttaagttatgta |
37191526 |
T |
 |
| Q |
277 |
gagtgatgatgtc |
289 |
Q |
| |
|
|||||||| |||| |
|
|
| T |
37191527 |
gagtgatgttgtc |
37191539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 1 - 33
Target Start/End: Complemental strand, 37191320 - 37191288
Alignment:
| Q |
1 |
tcgtacacaagcacaaacaaaactttagcccct |
33 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
37191320 |
tcgtacacaaacacaaacaaaactttagcccct |
37191288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University