View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21462_high_29 (Length: 237)
Name: NF21462_high_29
Description: NF21462
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21462_high_29 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 18 - 233
Target Start/End: Complemental strand, 11363890 - 11363674
Alignment:
| Q |
18 |
cctccgggtgagcatttgttgatcctcctgcagaatataggcagaccc-attaacgaaggaaggagttgttaacgaaatcttttaaaattagagtatact |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11363890 |
cctccgggtgagcatttgttgatcctcctgcagaatataggcagaccccattaacgaaggaaggagttgttaacgaaatcttttaaaattagagtatact |
11363791 |
T |
 |
| Q |
117 |
actattaccctactactagaagaaacacttctattgaaagtgaaagagagtaccacatcaagatatggaaagaccagttcaaaaacatcataagctaagt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11363790 |
actattaccctactactagaagaaacacttttattgaaagtgaaagagagtaccacatcaagatatggaaagaccagttcaaaaacatcataagctaagt |
11363691 |
T |
 |
| Q |
217 |
ttcgatgatgtccatct |
233 |
Q |
| |
|
||||| | ||||||||| |
|
|
| T |
11363690 |
ttcgaagctgtccatct |
11363674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University