View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21462_low_11 (Length: 348)
Name: NF21462_low_11
Description: NF21462
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21462_low_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 233; Significance: 1e-129; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 18 - 285
Target Start/End: Original strand, 35516313 - 35516581
Alignment:
| Q |
18 |
gttactcaggtttccccttggtcgattgaaagctagacggcttacacgagtaactgcatgacacgattattgtgtcacattaaaatctcatgtataagaa |
117 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
35516313 |
gttactcaggtttccccttagtcgattgaaagttagacggcttacacgagtaactgcgtgacacgattattgtgtcaaattaaaatctcatgtataagaa |
35516412 |
T |
 |
| Q |
118 |
gacatcaatttcttccaatcacgcaatcaagacattagtcattgtctgatatcgatctcatgcttc-aaaattagaaatgcacaagcctcgactcgattt |
216 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
35516413 |
gacatcaatttcttccaattacgcaatcaagacattagtcattgtctgatatcgatctcatgcttcaaaaattagaaatgcacaagcctcggctcgattt |
35516512 |
T |
 |
| Q |
217 |
tgtaacgtatttatgcccaaacgcaatgtgcgtgtttgatcaagtgaaaaatgaaaacaattaaaagag |
285 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35516513 |
tgtaacctatttatgcccaaacgcaatgtgcgtgtttgatcaagtgaaaaatgaaaacaattaaaagag |
35516581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 279 - 329
Target Start/End: Complemental strand, 35516655 - 35516605
Alignment:
| Q |
279 |
aaaagagtgtagtgttgtcctctaactaaactgggatgggacatgtaactc |
329 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
35516655 |
aaaagagtgtagtgttgtcctctaactaaacagggatgggacatgtaactc |
35516605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University