View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21462_low_27 (Length: 243)
Name: NF21462_low_27
Description: NF21462
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21462_low_27 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 421029 - 420805
Alignment:
| Q |
1 |
atgaagacaactccggtgcagcagccaccgatcaagcccaccgtcaaatcttcgaccactatgcttctcaagctatgttatccgacaactaccttaacgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
421029 |
atgaagacaactccggtgcagcagccaccgatcaagcccaccgtcaaatcttcgaccactatgcttctcaagctatgttatccgacaactaccttaacgg |
420930 |
T |
|
| Q |
101 |
acctggtggtggacccaccatcgacataaacagtggtgattttactcatcaccacaaccagtttagcccacacgcccagcagcaccataatatccatcag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
420929 |
acctggtggtggacccaccatcgacataaacagtggtgattttactcatcaccacaaccagtttagcccacacaaccagcagcaccataatatccatcag |
420830 |
T |
|
| Q |
201 |
tccttcttcgacccacgggcttttc |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
420829 |
tccttcttcgacccacgggcttttc |
420805 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University