View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21462_low_28 (Length: 240)
Name: NF21462_low_28
Description: NF21462
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21462_low_28 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 62 - 224
Target Start/End: Complemental strand, 23824889 - 23824727
Alignment:
| Q |
62 |
cttgcttgtttagaatttaattgtactcatattttagagaagtttgtgtagcagctaatgttctagctttgtttcggcagtgtttgcctctgttctttca |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23824889 |
cttgcttgtttagaatttaattgtactcatattttagagaagtttgtgtagcagctaatgttctagctttgtttcggcagtgtttgcctctgttctttca |
23824790 |
T |
|
| Q |
162 |
ttatttcttttttgtctcatgatagtcttgggcttcttcactttcgggtttctctgatgtaag |
224 |
Q |
| |
|
|| |||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23824789 |
ttgtttcttttttgtttcaagatagtcttgggcttcttcactttcgggtttctctgatgtaag |
23824727 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University