View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21466_high_7 (Length: 307)
Name: NF21466_high_7
Description: NF21466
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21466_high_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 119; Significance: 8e-61; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 119; E-Value: 8e-61
Query Start/End: Original strand, 1 - 155
Target Start/End: Original strand, 37483652 - 37483804
Alignment:
| Q |
1 |
cataaactctatcagtcaaacaccaaaaacaaatacaatttaagtctctgcgcaattatagagtgttttggttttagtccctgtaagnnnnnnngtttca |
100 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
37483652 |
cataaactctatcaatcaaacaccaaaaacaaatacaatttaagtctctgc--aattatagagtgttttggttttagtccctgtaagtttttttgtttca |
37483749 |
T |
|
| Q |
101 |
actcagtccctgcaaatttaaaacaagagtttttgaatttgcaggaaccgaatac |
155 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37483750 |
actcagtccctgcaaatttaaaacaagagtttttgaatttgcaggaaccgaatac |
37483804 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 106; E-Value: 5e-53
Query Start/End: Original strand, 194 - 307
Target Start/End: Original strand, 37483843 - 37483955
Alignment:
| Q |
194 |
cactataattgcggaaactagaatcatgaataacactataattgcggaaacttaaataataccaagatcataaacaacaggtctacttccagatttgcgt |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37483843 |
cactataattgcggaaactagaatcatgaataacactataatt-cggaaacttaaataataccaagatcataaacaacaggtctacttccagatttgcgt |
37483941 |
T |
|
| Q |
294 |
aagtgaggactatt |
307 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
37483942 |
aagtgaggactatt |
37483955 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University