View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21469_high_18 (Length: 339)
Name: NF21469_high_18
Description: NF21469
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21469_high_18 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 314; Significance: 1e-177; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 314; E-Value: 1e-177
Query Start/End: Original strand, 10 - 339
Target Start/End: Original strand, 16897820 - 16898149
Alignment:
| Q |
10 |
ccacagagtaaaaacctaccagactcgattctactttttagcatcaccctatcaaccaacaagctctcagctgatgattggaaactataatcacgcatct |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
16897820 |
ccacagagtaaaaacctaccagactcgattctactttttagcatcaccctatcaaccaacaagctctcagctgatgattggaaactataatcacggatct |
16897919 |
T |
|
| Q |
110 |
cgccataatttgatctcatagttggcaactttgaaacacttttttcaaacttttttatgtattgttggatatcttgctgaactgtagtggattcaaatgg |
209 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
16897920 |
cgccataatttgatctcatagttggcacctttgaaacacttttttcaaacttttttatgtattgttggatatcatgttgaactgtagtggattcaaatgg |
16898019 |
T |
|
| Q |
210 |
cttctgtgcaaaggagaagcagggtttagattcagtttccttgctatcggcagttgaactgacttgtccatgactagcttcctcagaatcaatgctggtt |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16898020 |
cttctgtgcaaaggagaagcagggtttagattcagtttccttgctatcggcagttgaactgacttgtccatgactagcttcctcagaatcaatgctggtt |
16898119 |
T |
|
| Q |
310 |
agtagctgcaatgtgtcataatggatatca |
339 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
16898120 |
agtagctgcaatgtgtcataatggatatca |
16898149 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University