View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21469_high_22 (Length: 324)
Name: NF21469_high_22
Description: NF21469
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21469_high_22 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 147; Significance: 2e-77; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 166 - 324
Target Start/End: Complemental strand, 10379663 - 10379505
Alignment:
| Q |
166 |
gcaacaatttaacactaggtcagaggctcgctgagggcaatgcgagcgatgcaaattcaaaaaacactatcctattaaatataacggaaaaatgcaatat |
265 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
10379663 |
gcaacaatttaacactagttcagaggctcgctgagggcaatgcgagcgatgcaaattcaaaaaacactatcctaataaatataacggaaaaatgcaatat |
10379564 |
T |
|
| Q |
266 |
atttataaataagccatattatatctagttaaatcaatattgtattattaacatagtga |
324 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
10379563 |
atttataaataagccatattatatctagttaaatcaatattgtactattaacatagtga |
10379505 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 22 - 131
Target Start/End: Complemental strand, 10379800 - 10379691
Alignment:
| Q |
22 |
tcatcaagcatacgagagaggcatcggagagtgttttgagttgcaacagaatgcagttttccatcagatggccatatggaactggcttctccaccctgac |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10379800 |
tcatcaagcatacgagagaggcatcggagagtgttttgagttgcaacagaatgcagttttccatcagatggccatatggaactggcttctccaccctgac |
10379701 |
T |
|
| Q |
122 |
tctcagttgg |
131 |
Q |
| |
|
|||||||||| |
|
|
| T |
10379700 |
tctcagttgg |
10379691 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University