View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2146_low_11 (Length: 340)
Name: NF2146_low_11
Description: NF2146
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2146_low_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 48; Significance: 2e-18; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 201 - 260
Target Start/End: Original strand, 16640365 - 16640424
Alignment:
| Q |
201 |
atcaccttaaacatactttttagtttatgcatgttgaaattataagggtgtgtgtggttt |
260 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||||||||||||||||||| |||||||||| |
|
|
| T |
16640365 |
atcaccttaaacatactatttagttgatgcatgttgaaattataagggtttgtgtggttt |
16640424 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 78 - 123
Target Start/End: Original strand, 16640240 - 16640285
Alignment:
| Q |
78 |
ggttcaattttgtgcaaatggatgggaaattagagtgtggtttatt |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16640240 |
ggttcaattttgtgcaaatggatgggaaattagagtgtggtttatt |
16640285 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University