View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2146_low_11 (Length: 340)

Name: NF2146_low_11
Description: NF2146
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2146_low_11
NF2146_low_11
[»] chr2 (2 HSPs)
chr2 (201-260)||(16640365-16640424)
chr2 (78-123)||(16640240-16640285)


Alignment Details
Target: chr2 (Bit Score: 48; Significance: 2e-18; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 201 - 260
Target Start/End: Original strand, 16640365 - 16640424
Alignment:
201 atcaccttaaacatactttttagtttatgcatgttgaaattataagggtgtgtgtggttt 260  Q
    ||||||||||||||||| ||||||| ||||||||||||||||||||||| ||||||||||    
16640365 atcaccttaaacatactatttagttgatgcatgttgaaattataagggtttgtgtggttt 16640424  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 78 - 123
Target Start/End: Original strand, 16640240 - 16640285
Alignment:
78 ggttcaattttgtgcaaatggatgggaaattagagtgtggtttatt 123  Q
    ||||||||||||||||||||||||||||||||||||||||||||||    
16640240 ggttcaattttgtgcaaatggatgggaaattagagtgtggtttatt 16640285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University