View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2146_low_21 (Length: 241)
Name: NF2146_low_21
Description: NF2146
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2146_low_21 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 11 - 217
Target Start/End: Original strand, 26954721 - 26954927
Alignment:
| Q |
11 |
gaagaaaaagactattgcaaattgcaatagagacaagaggagtaagtatgaattgatatttggttatttaaagaaaaagggaagacttcattcatagtgc |
110 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26954721 |
gaagaaaaagattattgcaaattgcaatagagacaagaggagtaagtatgaattgatatttggttatttaaagaaaaagggaagacttcattcatagtgc |
26954820 |
T |
|
| Q |
111 |
gcgcggtaatcaactgttggaattggagtttcaattattgttggtcattgcttttacgagtgtgatttcataatttgatattaaatttgttcaccttggt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26954821 |
gcgcggtaatcaactgttggaattggagtttcaattattgttggtcattgcttttaagagtgtgatttcataatttgatattaaatttgttcaccttggt |
26954920 |
T |
|
| Q |
211 |
gtagtct |
217 |
Q |
| |
|
||||||| |
|
|
| T |
26954921 |
gtagtct |
26954927 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University