View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21470_low_4 (Length: 397)
Name: NF21470_low_4
Description: NF21470
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21470_low_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 132; Significance: 2e-68; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 132; E-Value: 2e-68
Query Start/End: Original strand, 118 - 300
Target Start/End: Complemental strand, 6200024 - 6199842
Alignment:
| Q |
118 |
gaatgaattagggtttgaaatattaaaggtatttgtccctcacacatactttaaatatattttaaccatattgaaatcctgacaatatt-gtaatataga |
216 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| || |||||||||||||||| ||||||||||||| ||||| ||||| | || |||||||||| |
|
|
| T |
6200024 |
gaatgaattagggtttgaaatattataggtatttgtcc-tcgcacatactttaaatatgttttaaccatattcaaatcatgacattgtttgtaatataga |
6199926 |
T |
|
| Q |
217 |
tccatcaaagatcatgaattatagtttgtttattactataggcaggcactctttcgagattcaaatcctgacatacttgtgata |
300 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
6199925 |
tccatcaaagatcatgaattataatttgtttattactataggcaggcagtctttcgagattcaaatcctgacatacttgtgata |
6199842 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 331 - 373
Target Start/End: Complemental strand, 6199825 - 6199783
Alignment:
| Q |
331 |
atatttaatccataatattggttgagatttgattattttttat |
373 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6199825 |
atatttaatccataatattggttgagatttgattattttttat |
6199783 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University