View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21470_low_6 (Length: 235)
Name: NF21470_low_6
Description: NF21470
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21470_low_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 202; Significance: 1e-110; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 18 - 227
Target Start/End: Original strand, 44953695 - 44953904
Alignment:
| Q |
18 |
cattgagtccaatttgatatcattttctcccttttccttgcctttcttggggttcaatttaagtactactacatatttcaatttctaacaaattgttgat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44953695 |
cattgagtccaatttgatatcattttctcccttttccttgcctttcttggggttcaatttaagtactactacatatttcaatttctaacaaattgttgat |
44953794 |
T |
 |
| Q |
118 |
atatttcaaacaagttgaaatagatgaagtatacaaaaattgaagtataccgaagattgattgacatgagataaacataaaatttgagattccatgccaa |
217 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44953795 |
atatttcaaacaagttgaaatagattaagtatacaaaaattgaagtataccgaagattgattgacatgagataaacataaaatttgagattccatgccaa |
44953894 |
T |
 |
| Q |
218 |
atgatgatgt |
227 |
Q |
| |
|
||||| |||| |
|
|
| T |
44953895 |
atgataatgt |
44953904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 75 - 150
Target Start/End: Complemental strand, 44994845 - 44994770
Alignment:
| Q |
75 |
tttaagtactactacatatttcaatttctaacaaattgttgatatatttcaaacaagttgaaatagatgaagtata |
150 |
Q |
| |
|
|||| |||||||||||||| ||||||||| ||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
44994845 |
tttatgtactactacatatgtcaatttctgacaaattgttgatatatttcaaacaggttgaaatagatgaagtata |
44994770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University