View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21471_high_9 (Length: 243)
Name: NF21471_high_9
Description: NF21471
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21471_high_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 136; Significance: 5e-71; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 23 - 158
Target Start/End: Complemental strand, 1024671 - 1024536
Alignment:
| Q |
23 |
aggtttgctcaaatggggtgtaacatttttaaatgacacaacattttgataccgatagcacaatctttgctaccacatgcatgttaaaattaatggcgag |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1024671 |
aggtttgctcaaatggggtgtaacatttttaaatgacacaacattttgataccgatagcacaatctttgctaccacatgcatgttaaaattaatggcgag |
1024572 |
T |
 |
| Q |
123 |
tttggcagaaccacaatgtgttagtgtgattttggc |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
1024571 |
tttggcagaaccacaatgtgttagtgtgattttggc |
1024536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 185 - 233
Target Start/End: Complemental strand, 29085410 - 29085362
Alignment:
| Q |
185 |
aatttgaagggaagcaacaaatgagtctacgatgggttttcttctcatt |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || ||||| ||||||| |
|
|
| T |
29085410 |
aatttgaagggaagcaacaaatgagtctacgacggattttcctctcatt |
29085362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University