View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21472_high_16 (Length: 269)
Name: NF21472_high_16
Description: NF21472
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21472_high_16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 110; Significance: 2e-55; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 6 - 166
Target Start/End: Original strand, 40576085 - 40576243
Alignment:
| Q |
6 |
atcatctcattccttggtgcatgaagaaaagtaagaaaattcaagtaaaagttaccttgaaagtcatatttaattagggcctgaaaggtagacaaattgt |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
40576085 |
atcatctcattccttggtgcatgaagaaaagtaagaaaattcaagtgaaagttaccttgaaagtcatatttaattagtctgtgaaaggtagacaaattgt |
40576184 |
T |
 |
| Q |
106 |
tagccattaagggttattgtatcaatatgacttctccacactttttagtgggttaaatata |
166 |
Q |
| |
|
|||||||||||||| || ||||| ||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
40576185 |
cagccattaagggttgttatatca--atgtcttctccgcactttttagtgggttaaatata |
40576243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 71 - 166
Target Start/End: Original strand, 40568994 - 40569089
Alignment:
| Q |
71 |
atatttaattagggcctgaaaggtagacaaattgttagccattaagggttattgtatcaatatgacttctccacactttttagtgggttaaatata |
166 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40568994 |
atatttaattagggcgtgaaaggtagacaaattgttagccgttaagggttgttgtatcaatatgacttctccacactttttagtgggttaaatata |
40569089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 195 - 252
Target Start/End: Original strand, 40576822 - 40576873
Alignment:
| Q |
195 |
gttgcagtgaagcaactacttgacagaaatggaattcatcaagggaacatggtatttt |
252 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||| |
|
|
| T |
40576822 |
gttgcagtgaagcaact---tgacagaaatggaat---tcaagggaacatggtatttt |
40576873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 183 - 252
Target Start/End: Complemental strand, 22687169 - 22687105
Alignment:
| Q |
183 |
gcattgcaggttgttgcagtgaagcaactacttgacagaaatggaattcatcaagggaacatggtatttt |
252 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||| | || ||||||||||||| |
|
|
| T |
22687169 |
gcattgcaggttgttgcagtgaagca---acttgacagaaatggaattca--agggaaacatggtatttt |
22687105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University