View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21472_high_17 (Length: 246)

Name: NF21472_high_17
Description: NF21472
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21472_high_17
NF21472_high_17
[»] chr2 (1 HSPs)
chr2 (1-239)||(7665298-7665540)


Alignment Details
Target: chr2 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 7665298 - 7665540
Alignment:
1 gtccgatcgggtgagcatgtttcgcttgaagaaacaaagtacgttgtagcggtgatttttggctagagtttatgcttatatcgcttagtgaagtaatacg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7665298 gtccgatcgggtgagcatgtttcgcttgaagaaacaaagtacgttgtagcggtgatttttggctagagtttatgcttatatcgcttagtgaagtaatacg 7665397  T
101 caactatgacaagatacttgagttgtcctggagcaccggtggaaaaaggtttgaaa----tatttattcccggccatgcgaatggtcaaggcgaagtgag 196  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||| ||    ||||||||||| ||||||||||||||||||||||||||||    
7665398 caactatgacaagatacttgagttgtcctggagcaccggtggaaaagggtttggaatatttatttattcccagccatgcgaatggtcaaggcgaagtgag 7665497  T
197 aatgatgagtctcttggtgaatctatgtgcatatctctatatt 239  Q
    |||||||||||||||||||||||||||||||||||||||||||    
7665498 aatgatgagtctcttggtgaatctatgtgcatatctctatatt 7665540  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University