View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21472_low_11 (Length: 364)
Name: NF21472_low_11
Description: NF21472
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21472_low_11 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 42 - 351
Target Start/End: Complemental strand, 13328879 - 13328559
Alignment:
| Q |
42 |
gtcgccggcgaagtttcatgtgggtctattttaaacacgcgccctaccataagcaccaaaggtcgtcgacctatcaacacctaaaacgccactgccaat- |
140 |
Q |
| |
|
||||||||||||||||||| | || ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | | |
|
|
| T |
13328879 |
gtcgccggcgaagtttcatcagagtttatattaaacacgcgccctaccataagcaccaaaggtcgtcgacctatcaacacctaaaacgccactgcaatta |
13328780 |
T |
 |
| Q |
141 |
----taca------gacacacgccgccatcacattagataattatcggcttgtggagtacacgcgccaccctctgtgcatcaccttccaccgcggtttgt |
230 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||||||||| | |||||||||||| |||||||||||| |||||||||||| ||||||||| | |
|
|
| T |
13328779 |
tagatacacgtgtcgacacacgccgccatcacattaggtaattatcgacgtgtggagtacacacgccaccctctgggcatcaccttccgccgcggttttt |
13328680 |
T |
 |
| Q |
231 |
ctcatctgactcattttaccttcttggttctttttggaccccttccagtttttgggtcccacatttgaggtgcattttaatggcttttccgcatcagctg |
330 |
Q |
| |
|
|||||||||||| ||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
13328679 |
ctcatctgactcgtttccccttcttggttcattttggaccccttccagtttttgggtcccacatttgaggtgcgttttagtggcttttccgcatcagctg |
13328580 |
T |
 |
| Q |
331 |
cgttcgttcttgtgttggctc |
351 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
13328579 |
cgttcgttcttgtgttggctc |
13328559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University