View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21472_low_15 (Length: 289)
Name: NF21472_low_15
Description: NF21472
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21472_low_15 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 20 - 277
Target Start/End: Original strand, 10306862 - 10307119
Alignment:
| Q |
20 |
ctaggtgttgtcacgcctttcactccgactgtattgacaattggctccgttcttccaacctctcatgttgtccgctttgccgttccaccattttcgcttc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
10306862 |
ctaggtgttgtcacgcctttcactccgactgtattgacaattggctccgttcttccaacctctcatgttgtccgctttgccgttccacaattttcgcttc |
10306961 |
T |
|
| Q |
120 |
agaatccgacctcgcggcgattctccgatcaccttccgacagtttccgagttgaaattggaaatgtgacttatccagaagctgtcggcggagacgcattg |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10306962 |
agaatccgacctcgcggcgattctccgatcaccttccgacagtttccgagttgaaattggaaatgtgacttatccagaagctgtcggcggagacgcattg |
10307061 |
T |
|
| Q |
220 |
tcatcatattccattggaggatcattcgattatcgtgtaatggaggtatcacaggttc |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
10307062 |
tcatcatattccattggaggatcattcgattatcgtgtaatggaggtatcgcaggttc |
10307119 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 90; Significance: 2e-43; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 74 - 187
Target Start/End: Original strand, 1722082 - 1722195
Alignment:
| Q |
74 |
ccaacctctcatgttgtccgctttgccgttccaccattttcgcttcagaatccgacctcgcggcgattctccgatcaccttccgacagtttccgagttga |
173 |
Q |
| |
|
|||||||||||||||||| ||| |||| ||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
1722082 |
ccaacctctcatgttgtcggctctgccattccaccattttcgcttcagaattcgacctcgccgcgattctccgatcaccttccgacagtttccgagatga |
1722181 |
T |
|
| Q |
174 |
aattggaaatgtga |
187 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
1722182 |
aattggaaatgtga |
1722195 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University