View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21472_low_18 (Length: 246)
Name: NF21472_low_18
Description: NF21472
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21472_low_18 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 7665298 - 7665540
Alignment:
| Q |
1 |
gtccgatcgggtgagcatgtttcgcttgaagaaacaaagtacgttgtagcggtgatttttggctagagtttatgcttatatcgcttagtgaagtaatacg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7665298 |
gtccgatcgggtgagcatgtttcgcttgaagaaacaaagtacgttgtagcggtgatttttggctagagtttatgcttatatcgcttagtgaagtaatacg |
7665397 |
T |
|
| Q |
101 |
caactatgacaagatacttgagttgtcctggagcaccggtggaaaaaggtttgaaa----tatttattcccggccatgcgaatggtcaaggcgaagtgag |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||| || ||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
7665398 |
caactatgacaagatacttgagttgtcctggagcaccggtggaaaagggtttggaatatttatttattcccagccatgcgaatggtcaaggcgaagtgag |
7665497 |
T |
|
| Q |
197 |
aatgatgagtctcttggtgaatctatgtgcatatctctatatt |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7665498 |
aatgatgagtctcttggtgaatctatgtgcatatctctatatt |
7665540 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University