View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21474_low_2 (Length: 336)
Name: NF21474_low_2
Description: NF21474
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21474_low_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 206; Significance: 1e-112; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 5 - 223
Target Start/End: Complemental strand, 3129347 - 3129125
Alignment:
| Q |
5 |
ctctctcgcttccatctcctttaatagtaatgatttcataccttacacactttctctcttctttgttttaaaataaataaatgcttttgattctccctct |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3129347 |
ctctctcgcttccatctcctttaatagtaatgatttcataccttacacactttctctcttctttgttttaaaataaataaatgcttttgattctccctct |
3129248 |
T |
 |
| Q |
105 |
ttctctgcgcatgtaaaatctttgtttctatcagaagtggctcagaaagctttgtctcagatccctata----atactattacacaaacacaaacaccga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
3129247 |
ttctctgcgcatgtaaaatctttgtttctatcagaagtggctcagaaagctttgtctcagatccctataatacatactattacacaaacacaaacaccga |
3129148 |
T |
 |
| Q |
201 |
taataataacaatacatcaatcc |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
3129147 |
taataataacaatacatcaatcc |
3129125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University