View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21477_low_1 (Length: 371)
Name: NF21477_low_1
Description: NF21477
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21477_low_1 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 90 - 357
Target Start/End: Complemental strand, 36800220 - 36799952
Alignment:
| Q |
90 |
atgtcagcagaaataaagattctggagcttatgatttgggtgaattagatcaagccctttttctctatcttaatggacaaactgacccatccagtgttca |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36800220 |
atgtcagcagaaataaagattctggagcttatgatttgggtgaattagatcaagccctttttctctatcttaatggacaaactgacccatccagtgttca |
36800121 |
T |
 |
| Q |
190 |
agaccaaaaacgtgagnnnnnnnnnccttccaaatcccaataatgttt-gcttgaaattcaaaaagaaggagtcttttcctttcacttttggtttgttat |
288 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36800120 |
agaccaaaaacgtgagtttttttttcctttcaaatcccaataatgttttgcttgaaattcaaaaagaaggagtcttttcctttcacttttggtttgttat |
36800021 |
T |
 |
| Q |
289 |
agagaatctctttgttttacaccaatagcatgttcagcagaatcatatctgcagcagagtactaccttt |
357 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36800020 |
agagaatctctttgtttcacaccaatagcatgttcagcagaatcatatctgcagcagagtactaccttt |
36799952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University