View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21477_low_3 (Length: 205)
Name: NF21477_low_3
Description: NF21477
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21477_low_3 |
 | |
|
| [»] scaffold0014 (1 HSPs) |
| | |
|
Alignment Details
Target: chr2 (Bit Score: 159; Significance: 7e-85; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 1 - 198
Target Start/End: Complemental strand, 23962811 - 23962613
Alignment:
| Q |
1 |
tgatattcagttgttcaccaatatgttt-ggaaaatgctgcaaaatatacacaaaattataacgatgaaatttgtgtttttgaatgcgattttaatcaat |
99 |
Q |
| |
|
|||||||||||||||||| || |||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23962811 |
tgatattcagttgttcactaacatgttttggaaaatgctgcaaaatatatgcaaaattataacgatgaaatttgtgtttttgaatgcgattttaatcaat |
23962712 |
T |
|
| Q |
100 |
ataaataactataaaaattttagcggcataaaaactatacttaccataaccattgatttctttgacaacttcgaagtccatattataggattcatctct |
198 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| |||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23962711 |
ataaataactataaaatttttagcggcataaaaactatatttaccatagccattgatttctctgacaacttcgaagtccatattataggattcatctct |
23962613 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014 (Bit Score: 111; Significance: 3e-56; HSPs: 1)
Name: scaffold0014
Description:
Target: scaffold0014; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 1 - 198
Target Start/End: Original strand, 132758 - 132942
Alignment:
| Q |
1 |
tgatattcagttgttcaccaatatgttt-ggaaaatgctgcaaaatatacacaaaattataacgatgaaatttgtgtttttgaatgcgattttaatcaat |
99 |
Q |
| |
|
||||||||||||| ||||||| |||||| |||||||||||||||||||| ||||||| ||||||||||||| ||||||| |||||||| |
|
|
| T |
132758 |
tgatattcagttgctcaccaacatgttttggaaaatgctgcaaaatatatacaaaat---aacgatgaaatttttgttttt-----------taatcaat |
132843 |
T |
|
| Q |
100 |
ataaataactataaaaattttagcggcataaaaactatacttaccataaccattgatttctttgacaacttcgaagtccatattataggattcatctct |
198 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
132844 |
ataaataactataaattttttaacggcataaaaactatacttaccataaccattgatttctttgacaacttcgaagtccatattataggattcatctct |
132942 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University