View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21478_high_15 (Length: 231)
Name: NF21478_high_15
Description: NF21478
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21478_high_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 18 - 220
Target Start/End: Original strand, 5995735 - 5995942
Alignment:
| Q |
18 |
ttccccttcctcgcataaaccaccggcgtgaaaacaatcactttcttatactgttcacggccgaaaaactctctgatgaagcattcaagagatgggaccc |
117 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5995735 |
ttccccttcctcgcataaaccaacggcgtgaaaacaatcactttcgtatactgttcacggccgaaaaactctctgatgaagcattcaagagatgggaccc |
5995834 |
T |
 |
| Q |
118 |
aaacgttagctgcatcacattcctctcattctttctttcaactcacctatttctttctctcctccttttatttaatttaat-----ttgtggtgaaacaa |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| || |||||||||||||| |
|
|
| T |
5995835 |
aaacgttagctgcatcacattcctctcattctttctttcaactcacctatttctttctctcctccttttattttattttattttacttgtggtgaaacaa |
5995934 |
T |
 |
| Q |
213 |
tattcttc |
220 |
Q |
| |
|
|||||||| |
|
|
| T |
5995935 |
tattcttc |
5995942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University