View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21478_low_9 (Length: 369)
Name: NF21478_low_9
Description: NF21478
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21478_low_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 319; Significance: 1e-180; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 319; E-Value: 1e-180
Query Start/End: Original strand, 24 - 354
Target Start/End: Complemental strand, 18040315 - 18039985
Alignment:
| Q |
24 |
gacgaagaagacgaactcggcgtcccttctccacttgatatccccttcaacctagcttccatctccttcccccatgtcctcgtcctccgaaacttctccg |
123 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
18040315 |
gacgaagaagacgaacttggcgtcccttctccacttgatatccccttcaacctagcttccatctccttcccccacgtcctcgtcctccgaaacttctccg |
18040216 |
T |
 |
| Q |
124 |
agtcagaaacttctgactcggagccaccgtttcggaggcgggttgcaggagtacaaggattacagcttttgtatacacctgaagctttcaatgccatgtc |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18040215 |
agtcagaaacttctgactcggagccaccgtttcggaggcgggttgcaggagtacaaggattacagcttttgtatacacctgaagctttcaatgccatgtc |
18040116 |
T |
 |
| Q |
224 |
ttttatctgacatgtcaaggattttacgctctttgcattgttgtttgattctgaatcttcttcgagtttctttggacgtgctatgcatgtaagcatgttt |
323 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18040115 |
ttttatctgacatgtcaaagattttacgctctttgcattgttgtttgattctgaatcttcttcgagtttctttggacgtgctatgcatgtaagcatgttt |
18040016 |
T |
 |
| Q |
324 |
tttgttctttggaattcagatcgtgtttgtg |
354 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
18040015 |
tttgttctttggaattcagatcgtgtttgtg |
18039985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University