View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21479_high_1 (Length: 429)
Name: NF21479_high_1
Description: NF21479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21479_high_1 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 230; Significance: 1e-127; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 171 - 400
Target Start/End: Original strand, 34899746 - 34899975
Alignment:
| Q |
171 |
gtcagtgatatcatctgcacaaattcacataaaattttgtagttggaagatacatacctttcatgtttggtgagaatggaaggaaaattttgagactata |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34899746 |
gtcagtgatatcatctgcacaaattcacataaaattttgtagttggaagatacatacctttcatgtttggtgagaatggaaggaaaattttgagactata |
34899845 |
T |
|
| Q |
271 |
aggttgcatacacgcaggggaagacacaatttagcttttgttgacatcaaatagcgagagaagaactaaagagagatgtgtttatatgcatataggtaaa |
370 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34899846 |
aggttgcatacacgcaggggaagacacaatttagcttttgttgacatcaaatagcgagagaagaactaaagagagatgtgtttatatgcatataggtaaa |
34899945 |
T |
|
| Q |
371 |
gtttggtagtttcaactttcaagttgagat |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
34899946 |
gtttggtagtttcaactttcaagttgagat |
34899975 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 112; E-Value: 2e-56
Query Start/End: Original strand, 1 - 112
Target Start/End: Complemental strand, 34899975 - 34899864
Alignment:
| Q |
1 |
atctcaacttgaaagttgaaactaccaaactttacctatatgcatataaacacatctctctttagttcttctctcgctatttgatgtcaacaaaagctaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34899975 |
atctcaacttgaaagttgaaactaccaaactttacctatatgcatataaacacatctctctttagttcttctctcgctatttgatgtcaacaaaagctaa |
34899876 |
T |
|
| Q |
101 |
attgtgtcttcc |
112 |
Q |
| |
|
|||||||||||| |
|
|
| T |
34899875 |
attgtgtcttcc |
34899864 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University