View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21481_high_2 (Length: 321)
Name: NF21481_high_2
Description: NF21481
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21481_high_2 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 171; Significance: 8e-92; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 171; E-Value: 8e-92
Query Start/End: Original strand, 19 - 193
Target Start/End: Complemental strand, 9514712 - 9514538
Alignment:
| Q |
19 |
tgaatgtttcagattgaagaagactttagaatttaggcattttgatgacatattttggccttgcctaactttgttcaattctgaaagtgcattggatcaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9514712 |
tgaatgtttcagattgaagaagactttagaatttaggcattttgatgacatattttggccttgcctaactttgttcaattctgaaagtgcattggatcaa |
9514613 |
T |
|
| Q |
119 |
aataacattgaatgttgtgcaaatgagcttggagaaactagctatgcccaagagaactctcaagtgtgaacttgt |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
9514612 |
aataacattgaatgttgtgcaaatgagcttggagaaactagctatgcccaagagaactcttaagtgtgaacttgt |
9514538 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 262 - 311
Target Start/End: Complemental strand, 9514469 - 9514420
Alignment:
| Q |
262 |
gggaatgcatgttaggctaatttttattcaatttcagtttcttttatatt |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
9514469 |
gggaatgcatgttaggctaatttttattcaattccagtttcttttatatt |
9514420 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 37 - 102
Target Start/End: Complemental strand, 9518121 - 9518056
Alignment:
| Q |
37 |
gaagactttagaatttaggcattttgatgacatattttggccttgcctaactttgttcaattctga |
102 |
Q |
| |
|
|||||||| |||||||| |||| ||||||||||||||| |||||||||| |||| ||||||||||| |
|
|
| T |
9518121 |
gaagacttcagaatttaagcatattgatgacatattttagccttgcctatctttattcaattctga |
9518056 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University