View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21485_high_6 (Length: 351)

Name: NF21485_high_6
Description: NF21485
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21485_high_6
NF21485_high_6
[»] chr4 (7 HSPs)
chr4 (160-329)||(5646710-5646876)
chr4 (21-161)||(45687630-45687770)
chr4 (26-162)||(36463835-36463971)
chr4 (26-151)||(52467778-52467903)
chr4 (65-162)||(24334560-24334657)
chr4 (100-162)||(46147789-46147851)
chr4 (65-164)||(3793592-3793692)
[»] chr3 (9 HSPs)
chr3 (26-162)||(29196865-29197001)
chr3 (26-162)||(9666901-9667037)
chr3 (50-162)||(28074023-28074135)
chr3 (26-160)||(44700927-44701062)
chr3 (62-162)||(25796287-25796387)
chr3 (27-162)||(31314120-31314250)
chr3 (78-161)||(3715496-3715579)
chr3 (66-162)||(47650077-47650174)
chr3 (58-98)||(24177024-24177064)
[»] chr8 (8 HSPs)
chr8 (28-162)||(18141421-18141555)
chr8 (26-162)||(5688849-5688985)
chr8 (51-162)||(40320709-40320820)
chr8 (53-157)||(8149951-8150054)
chr8 (65-161)||(26402719-26402816)
chr8 (65-162)||(9765387-9765483)
chr8 (25-98)||(30291215-30291289)
chr8 (73-161)||(6127733-6127822)
[»] chr2 (6 HSPs)
chr2 (26-161)||(36773147-36773283)
chr2 (26-158)||(33162866-33162998)
chr2 (65-162)||(34681824-34681921)
chr2 (65-162)||(42269879-42269977)
chr2 (64-158)||(31056557-31056652)
chr2 (88-161)||(11066953-11067026)
[»] chr7 (6 HSPs)
chr7 (26-148)||(12098246-12098368)
chr7 (28-162)||(24526351-24526486)
chr7 (50-154)||(8152976-8153080)
chr7 (53-156)||(22269362-22269464)
chr7 (26-106)||(41317954-41318034)
chr7 (89-154)||(41317888-41317953)
[»] chr1 (9 HSPs)
chr1 (26-158)||(28266025-28266157)
chr1 (20-154)||(50169630-50169765)
chr1 (26-154)||(50167608-50167737)
chr1 (53-156)||(47256004-47256106)
chr1 (26-162)||(776847-776981)
chr1 (26-98)||(8871594-8871666)
chr1 (24-98)||(45644826-45644900)
chr1 (65-162)||(47703428-47703525)
chr1 (62-162)||(40816325-40816425)
[»] chr6 (2 HSPs)
chr6 (25-162)||(3039368-3039506)
chr6 (62-158)||(21800909-21801005)
[»] chr5 (4 HSPs)
chr5 (53-156)||(28277722-28277824)
chr5 (65-162)||(10282218-10282316)
chr5 (65-162)||(3881240-3881338)
chr5 (58-145)||(16642543-16642629)
[»] scaffold0148 (1 HSPs)
scaffold0148 (65-162)||(11238-11335)
[»] scaffold0477 (1 HSPs)
scaffold0477 (65-162)||(5446-5545)


Alignment Details
Target: chr4 (Bit Score: 104; Significance: 8e-52; HSPs: 7)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 104; E-Value: 8e-52
Query Start/End: Original strand, 160 - 329
Target Start/End: Original strand, 5646710 - 5646876
Alignment:
160 tggaagacggatggtcttgagtatcgtaagaaggtttcgagttctaaagaaaagaaatccggtgaagatgtttctaaggctgctgttgctgctgcgagtt 259  Q
    |||||||| |||||||||| ||||||||| |||||||||||  || | |||||||||||||||||||||||||||||||||||||   |||||| |||||    
5646710 tggaagactgatggtcttgtgtatcgtaaaaaggtttcgagcactgatgaaaagaaatccggtgaagatgtttctaaggctgctg---ctgctgtgagtt 5646806  T
260 ctgaagagaaagaagtgagtaaggagaatgagctggagaagtgggatgctgaatttattaaggttgataa 329  Q
    |||||||||||| ||||||||||||| |||||||||| |||||||||||||| ||| |||||||||||||    
5646807 ctgaagagaaagtagtgagtaaggaggatgagctggataagtgggatgctgagtttgttaaggttgataa 5646876  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 21 - 161
Target Start/End: Complemental strand, 45687770 - 45687630
Alignment:
21 aaaactgttgaaatgtgtctcgagtttggtgttgaagtctggaaaaatcgtggcacttttgcagggcaacgtggcacggttgaatggttcagcttttggg 120  Q
    ||||||||||||||||||||| |  ||| ||||||||| ||||||||||||||||| ||||||||||||||||| ||| ||||||||||||| |||||||    
45687770 aaaactgttgaaatgtgtctcaaaattgatgttgaagtttggaaaaatcgtggcacgtttgcagggcaacgtggtacgattgaatggttcagtttttggg 45687671  T
121 ttgccactggaaaatttgtggcacgatgcaggaggaacgtg 161  Q
    |||||||||||||| | |||||||||| |||||||||||||    
45687670 ttgccactggaaaagtcgtggcacgatccaggaggaacgtg 45687630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 26 - 162
Target Start/End: Complemental strand, 36463971 - 36463835
Alignment:
26 tgttgaaatgtgtctcgagtttggtgttgaagtctggaaaaatcgtggcacttttgcagggcaacgtggcacggttgaatggttcagcttttgggttgcc 125  Q
    |||||||||||||||| |  ||| | ||||||| ||||| ||||||||||| |||||||||||||||| |||| ||||||||||||| ||||||||||||    
36463971 tgttgaaatgtgtctcaaaattgatattgaagtttggaacaatcgtggcacgtttgcagggcaacgtgacacgattgaatggttcagtttttgggttgcc 36463872  T
126 actggaaaatttgtggcacgatgcaggaggaacgtgg 162  Q
    | || |||| | |||||||||||||||||||||||||    
36463871 attgaaaaaatcgtggcacgatgcaggaggaacgtgg 36463835  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 26 - 151
Target Start/End: Complemental strand, 52467903 - 52467778
Alignment:
26 tgttgaaatgtgtctcgagtttggtgttgaagtctggaaaaatcgtggcacttttgcagggcaacgtggcacggttgaatggttcagcttttgggttgcc 125  Q
    |||||||||||||||| |  ||| |||||||||||  || ||||||||||| ||||||||||||||||||||| ||||||||||||| ||||||||||||    
52467903 tgttgaaatgtgtctcaaaattgatgttgaagtctaaaacaatcgtggcacgtttgcagggcaacgtggcacgattgaatggttcaggttttgggttgcc 52467804  T
126 actggaaaatttgtggcacgatgcag 151  Q
    | || |||| | | ||||||||||||    
52467803 attgaaaaaatcgaggcacgatgcag 52467778  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 65 - 162
Target Start/End: Complemental strand, 24334657 - 24334560
Alignment:
65 aaatcgtggcacttttgcagggcaacgtggcacggttgaatggttcagcttttgggttgccactggaaaatttgtggcacgatgcaggaggaacgtgg 162  Q
    |||||||||||| |||||||||||||||| |||| ||| ||||||||| ||| |  ||| |  |||||||||||||||||||| ||| ||||||||||    
24334657 aaatcgtggcacgtttgcagggcaacgtgtcacgattggatggttcagatttggatttgtcgttggaaaatttgtggcacgatccagaaggaacgtgg 24334560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 100 - 162
Target Start/End: Complemental strand, 46147851 - 46147789
Alignment:
100 ttgaatggttcagcttttgggttgccactggaaaatttgtggcacgatgcaggaggaacgtgg 162  Q
    ||||||||||||| ||| || ||| |||||||||| | |||||||||| ||||||||||||||    
46147851 ttgaatggttcaggtttgggtttgtcactggaaaaatcgtggcacgatccaggaggaacgtgg 46147789  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 65 - 164
Target Start/End: Original strand, 3793592 - 3793692
Alignment:
65 aaatcgtggcacttttgcagggcaacgtggcacggttgaatggttcagcttttggg-ttgccactggaaaatttgtggcacgatgcaggaggaacgtgga 163  Q
    |||||||||||| ||||||||| ||| ||| ||| ||| ||||||||| | ||||| ||  | |||||||| | |||||||||| |||||||||| ||||    
3793592 aaatcgtggcacgtttgcagggaaacatggtacgattggatggttcagatattgggtttttcgctggaaaaatcgtggcacgatccaggaggaacatgga 3793691  T
164 a 164  Q
    |    
3793692 a 3793692  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 85; Significance: 2e-40; HSPs: 9)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 26 - 162
Target Start/End: Complemental strand, 29197001 - 29196865
Alignment:
26 tgttgaaatgtgtctcgagtttggtgttgaagtctggaaaaatcgtggcacttttgcagggcaacgtggcacggttgaatggttcagcttttgggttgcc 125  Q
    |||||||||||||||| |  ||| ||||||||| ||| ||||||||||||| ||||||||||||||||||||| ||||||||||||  ||||||||||||    
29197001 tgttgaaatgtgtctcaaaattgatgttgaagtttgggaaaatcgtggcacgtttgcagggcaacgtggcacgattgaatggttcaatttttgggttgcc 29196902  T
126 actggaaaatttgtggcacgatgcaggaggaacgtgg 162  Q
    ||||||||| | |||||||||| ||||||||||||||    
29196901 actggaaaaatcgtggcacgatccaggaggaacgtgg 29196865  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 26 - 162
Target Start/End: Complemental strand, 9667037 - 9666901
Alignment:
26 tgttgaaatgtgtctcgagtttggtgttgaagtctggaaaaatcgtggcacttttgcagggcaacgtggcacggttgaatggttcagcttttgggttgcc 125  Q
    |||||||||||||||| |  ||  ||||||||| ||||| ||||||||||| ||||||||||||||||||||| ||||| ||||||| ||||||||||||    
9667037 tgttgaaatgtgtctcaaaattaatgttgaagtttggaacaatcgtggcacgtttgcagggcaacgtggcacgattgaagggttcagtttttgggttgcc 9666938  T
126 actggaaaatttgtggcacgatgcaggaggaacgtgg 162  Q
    ||||||||| | |||||||||| ||||||||||||||    
9666937 actggaaaaatcgtggcacgatccaggaggaacgtgg 9666901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 50 - 162
Target Start/End: Original strand, 28074023 - 28074135
Alignment:
50 tgttgaagtctggaaaaatcgtggcacttttgcagggcaacgtggcacggttgaatggttcagcttttgggttgccactggaaaatttgtggcacgatgc 149  Q
    ||||||||| | ||||||| ||||||| ||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||| | |||||||||| |    
28074023 tgttgaagtttagaaaaattgtggcacgtttgcagggcaacgtggcacgattgaatggttcagtttttgggttgccactggaaaaatcgtggcacgatcc 28074122  T
150 aggaggaacgtgg 162  Q
    |||||||||||||    
28074123 aggaggaacgtgg 28074135  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 26 - 160
Target Start/End: Complemental strand, 44701062 - 44700927
Alignment:
26 tgttgaaatgtgtctcgagtttggtgttgaagtctggaaaaatc-gtggcacttttgcagggcaacgtggcacggttgaatggttcagcttttgggttgc 124  Q
    |||||||||||||||| |  ||| | |||||||||||||||| | ||||||| ||||||||||||||||||||| ||||||||||||| ||||||||| |    
44701062 tgttgaaatgtgtctcaaaattgattttgaagtctggaaaaaaccgtggcacgtttgcagggcaacgtggcacgattgaatggttcagtttttgggttac 44700963  T
125 cactggaaaatttgtggcacgatgcaggaggaacgt 160  Q
    |||||||||| | |||||||||| ||||||||||||    
44700962 cactggaaaaatcgtggcacgatccaggaggaacgt 44700927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 62 - 162
Target Start/End: Complemental strand, 25796387 - 25796287
Alignment:
62 gaaaaatcgtggcacttttgcagggcaacgtggcacggttgaatggttcagcttttgggttgccactggaaaatttgtggcacgatgcaggaggaacgtg 161  Q
    ||||||||||||||| ||||||||||||||||||||| ||| ||| ||||| |||||| ||| |||||||||| | ||| |||||| |||||||||||||    
25796387 gaaaaatcgtggcacgtttgcagggcaacgtggcacgattggatgattcaggttttggtttgtcactggaaaaatcgtgacacgatccaggaggaacgtg 25796288  T
162 g 162  Q
    |    
25796287 g 25796287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 27 - 162
Target Start/End: Original strand, 31314120 - 31314250
Alignment:
27 gttgaaatgtgtctcgagtttggtgttgaagtctggaaaaatcgtggcacttttgcagggcaacgtggcacggttgaatggttcagcttttgggttgcca 126  Q
    ||||||||||||||| |  ||| ||||||||| || |||||||||||||| ||||||||| || | | ||||     ||||||||| |||||||| ||||    
31314120 gttgaaatgtgtctcaaaattgatgttgaagtttgaaaaaatcgtggcacgtttgcagggtaatgcgacacg-----atggttcagtttttgggtcgcca 31314214  T
127 ctggaaaatttgtggcacgatgcaggaggaacgtgg 162  Q
    |||||||| | |||||||||| || |||||||||||    
31314215 ctggaaaaatcgtggcacgatccaagaggaacgtgg 31314250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 78 - 161
Target Start/End: Original strand, 3715496 - 3715579
Alignment:
78 tttgcagggcaacgtggcacggttgaatggttcagcttttgggttgccactggaaaatttgtggcacgatgcaggaggaacgtg 161  Q
    ||||||||||||||||||||| |||  |||||||| |||  | ||| | |||||||| |||||||||||| |||||||||||||    
3715496 tttgcagggcaacgtggcacgattggttggttcagatttgtgtttgtcgctggaaaaattgtggcacgatccaggaggaacgtg 3715579  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 66 - 162
Target Start/End: Complemental strand, 47650174 - 47650077
Alignment:
66 aatcgtggcact-tttgcagggcaacgtggcacggttgaatggttcagcttttgggttgccactggaaaatttgtggcacgatgcaggaggaacgtgg 162  Q
    |||||||||||  ||||||||||||||||||||| |||  |||||||| ||| || ||| |  ||||||| || ||||||||| ||||||||||||||    
47650174 aatcgtggcacgatttgcagggcaacgtggcacgattggttggttcagatttgggtttgtcgttggaaaaattatggcacgatccaggaggaacgtgg 47650077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 58 - 98
Target Start/End: Original strand, 24177024 - 24177064
Alignment:
58 tctggaaaaatcgtggcacttttgcagggcaacgtggcacg 98  Q
    |||||| |||||||||||| |||||||||||||||||||||    
24177024 tctggagaaatcgtggcacgtttgcagggcaacgtggcacg 24177064  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 83; Significance: 3e-39; HSPs: 8)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 28 - 162
Target Start/End: Original strand, 18141421 - 18141555
Alignment:
28 ttgaaatgtgtctcgagtttggtgttgaagtctggaaaaatcgtggcacttttgcagggcaacgtggcacggttgaatggttcagcttttgggttgccac 127  Q
    |||||||||||||| |  ||| ||||||||||||||| ||||||||||| ||||||||||||||| ||||| ||||| ||||||| ||||||||||||||    
18141421 ttgaaatgtgtctcaaaattgatgttgaagtctggaacaatcgtggcacgtttgcagggcaacgtcgcacgattgaacggttcagtttttgggttgccac 18141520  T
128 tggaaaatttgtggcacgatgcaggaggaacgtgg 162  Q
    ||||||| || ||||||||| ||||||||||||||    
18141521 tggaaaaattatggcacgatccaggaggaacgtgg 18141555  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 26 - 162
Target Start/End: Original strand, 5688849 - 5688985
Alignment:
26 tgttgaaatgtgtctcgagtttggtgttgaagtctggaaaaatcgtggcacttttgcagggcaacgtggcacggttgaatggttcagcttttgggttgcc 125  Q
    |||||||||||||||| |  ||| ||||||||| ||||||||||||||||| ||||||||||||||||||||| ||||||||||||| |||| ||||| |    
5688849 tgttgaaatgtgtctcaaaattgatgttgaagtttggaaaaatcgtggcacgtttgcagggcaacgtggcacgattgaatggttcagttttttggttgtc 5688948  T
126 actggaaaatttgtggcacgatgcaggaggaacgtgg 162  Q
    |||| |||| | |||||||||| ||||||||||||||    
5688949 actgaaaaaatcgtggcacgatccaggaggaacgtgg 5688985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 51 - 162
Target Start/End: Original strand, 40320709 - 40320820
Alignment:
51 gttgaagtctggaaaaatcgtggcacttttgcagggcaacgtggcacggttgaatggttcagcttttgggttgccactggaaaatttgtggcacgatgca 150  Q
    |||||||| ||||||||||||||||  ||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||| | ||||||| ||| |    
40320709 gttgaagtttggaaaaatcgtggcatgtttgcagggcaacgtggcacgattgaatggttcagtttttgggttgccactggaaaaatcgtggcacaatgta 40320808  T
151 ggaggaacgtgg 162  Q
    ||||||||||||    
40320809 ggaggaacgtgg 40320820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 53 - 157
Target Start/End: Complemental strand, 8150054 - 8149951
Alignment:
53 tgaagtctggaaaaatcgtggcacttttgcagggcaacgtggcacggttgaatggttcagcttttgggttgccactggaaaatttgtggcacgatgcagg 152  Q
    |||||||||||||| ||||||||| |||||||||||| |||||||| ||||||||||||| ||||||||||||||| ||||||| ||||||||||  |||    
8150054 tgaagtctggaaaa-tcgtggcacgtttgcagggcaatgtggcacgattgaatggttcagtttttgggttgccactagaaaattcgtggcacgatctagg 8149956  T
153 aggaa 157  Q
    |||||    
8149955 aggaa 8149951  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 65 - 161
Target Start/End: Original strand, 26402719 - 26402816
Alignment:
65 aaatcgtggcacttttgcagggcaacgtggcacggttgaatggttcagcttttgggttgcca-ctggaaaatttgtggcacgatgcaggaggaacgtg 161  Q
    |||||||||||| ||||||||||||||||||||| ||| ||||||||| |||||||||   | |||||||||| |||||||||| ||||| |||||||    
26402719 aaatcgtggcacgtttgcagggcaacgtggcacgattggatggttcagattttgggtttatagctggaaaattcgtggcacgattcaggatgaacgtg 26402816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 65 - 162
Target Start/End: Original strand, 9765387 - 9765483
Alignment:
65 aaatcgtggcacttttgcagggcaacgtggcacggttgaatggttcagcttttgggttgccactggaaaatttgtggcacgatgcaggaggaacgtgg 162  Q
    |||||||||||| ||||||||||||||||||||| ||| ||||||||  ||| || ||| ||| |||||| |  ||||||||| ||||||||||||||    
9765387 aaatcgtggcacgtttgcagggcaacgtggcacgattggatggttcatatttgggtttgtcac-ggaaaaatcatggcacgatccaggaggaacgtgg 9765483  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 25 - 98
Target Start/End: Original strand, 30291215 - 30291289
Alignment:
25 ctgttgaaatgtgtctcgagtttggtgttgaagtctggaaaaatcgtggcacttttgcagg-gcaacgtggcacg 98  Q
    ||||||||||||||||| |  ||| |||||||||||||||||||||| |||| |||||||| | |||||||||||    
30291215 ctgttgaaatgtgtctcaaaattgatgttgaagtctggaaaaatcgtcgcacgtttgcaggaggaacgtggcacg 30291289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 73 - 161
Target Start/End: Complemental strand, 6127822 - 6127733
Alignment:
73 gcacttttgcagggcaacgtggcacggttgaatggttcagcttttggg-ttgccactggaaaatttgtggcacgatgcaggaggaacgtg 161  Q
    |||| |||||||||||| |||||||| ||| ||||||||| ||||||| ||| | || ||||| |||||||||||| ||  |||||||||    
6127822 gcacgtttgcagggcaatgtggcacgattggatggttcagattttgggtttgtcgctagaaaaattgtggcacgatccaataggaacgtg 6127733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 81; Significance: 4e-38; HSPs: 6)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 26 - 161
Target Start/End: Original strand, 36773147 - 36773283
Alignment:
26 tgttgaaatgtgtctcgagtttggtgtt-gaagtctggaaaaatcgtggcacttttgcagggcaacgtggcacggttgaatggttcagcttttgggttgc 124  Q
    |||||||||||||||| |  ||| |||| ||||| || |||||||||||||  ||||||||||||||||||||| ||||||||||||| |||||||||||    
36773147 tgttgaaatgtgtctcaaaattgatgtttgaagtttgaaaaaatcgtggcatgtttgcagggcaacgtggcacgattgaatggttcagtttttgggttgc 36773246  T
125 cactggaaaatttgtggcacgatgcaggaggaacgtg 161  Q
    |||||||||| |||||||||||| |||||||||||||    
36773247 cactggaaaaattgtggcacgatccaggaggaacgtg 36773283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 26 - 158
Target Start/End: Complemental strand, 33162998 - 33162866
Alignment:
26 tgttgaaatgtgtctcgagtttggtgttgaagtctggaaaaatcgtggcacttttgcagggcaacgtggcacggttgaatggttcagcttttgggttgcc 125  Q
    |||||||||||||||| |  ||| || |||||| ||||||||||||||||  |||| |||| ||||||||||| ||||||||||||| ||||||||||||    
33162998 tgttgaaatgtgtctcaaaattgatgatgaagtttggaaaaatcgtggcatgtttgtagggaaacgtggcacgattgaatggttcagtttttgggttgcc 33162899  T
126 actggaaaatttgtggcacgatgcaggaggaac 158  Q
    ||||||||| | |||||||||| ||||||||||    
33162898 actggaaaaatcgtggcacgatccaggaggaac 33162866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 65 - 162
Target Start/End: Original strand, 34681824 - 34681921
Alignment:
65 aaatcgtggcacttttgcagggcaacgtggcacggttgaatggttcagcttttgggttgccactggaaaatttgtggcacgatgcaggaggaacgtgg 162  Q
    |||||||||||| ||||||||||||||||||||| ||| ||||||||| ||| || ||| |||||||||| | |||||||||| ||| ||||||||||    
34681824 aaatcgtggcacgtttgcagggcaacgtggcacgattggatggttcaggtttgggtttgtcactggaaaaatcgtggcacgatccagtaggaacgtgg 34681921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 65 - 162
Target Start/End: Complemental strand, 42269977 - 42269879
Alignment:
65 aaatcgtggcacttttgcagggcaacgtggcacggttgaatggttcagcttttg-ggttgccactggaaaatttgtggcacgatgcaggaggaacgtgg 162  Q
    |||||||||||| ||||||||||||||||||||| ||| ||||||||| ||||| | ||| | |||||||| | |||||| ||| ||||||||||||||    
42269977 aaatcgtggcacgtttgcagggcaacgtggcacgattggatggttcaggttttgcgtttgtcgctggaaaaatcgtggcaggatccaggaggaacgtgg 42269879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 64 - 158
Target Start/End: Complemental strand, 31056652 - 31056557
Alignment:
64 aaaatcgtggcacttttgcagggcaacgtggcacggttgaatggttcagcttttggg-ttgccactggaaaatttgtggcacgatgcaggaggaac 158  Q
    ||||||||||||| ||||||||||||||||||||  ||| ||||||||| ||||||| ||| |||||||||| |  ||||||||| ||| ||||||    
31056652 aaaatcgtggcacatttgcagggcaacgtggcacaattggatggttcagattttgggtttgtcactggaaaaatcatggcacgatccagaaggaac 31056557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 88 - 161
Target Start/End: Original strand, 11066953 - 11067026
Alignment:
88 aacgtggcacggttgaatggttcagcttttgggttgccactggaaaatttgtggcacgatgcaggaggaacgtg 161  Q
    ||||||||||| ||||| ||||||| |||||||||||||||| |||| | ||||||||||  ||||||||||||    
11066953 aacgtggcacgattgaagggttcagtttttgggttgccactgaaaaaatcgtggcacgatctaggaggaacgtg 11067026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 75; Significance: 2e-34; HSPs: 6)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 26 - 148
Target Start/End: Complemental strand, 12098368 - 12098246
Alignment:
26 tgttgaaatgtgtctcgagtttggtgttgaagtctggaaaaatcgtggcacttttgcagggcaacgtggcacggttgaatggttcagcttttgggttgcc 125  Q
    |||||||||||||||| |  ||| ||||||||| ||||||||||||||||| |||||||||||||||| |||| ||||||||||||| |||||| |||||    
12098368 tgttgaaatgtgtctcaaaattgatgttgaagtttggaaaaatcgtggcacgtttgcagggcaacgtgacacgattgaatggttcagtttttggattgcc 12098269  T
126 actggaaaatttgtggcacgatg 148  Q
    ||||||||| | |||||||||||    
12098268 actggaaaaatcgtggcacgatg 12098246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 28 - 162
Target Start/End: Complemental strand, 24526486 - 24526351
Alignment:
28 ttgaaatgtgtctcgagtttggtgttgaagtctggaaaaatcgtggcacttttgcagggcaacgtggcacggttgaatggttcagcttttggg-ttgcca 126  Q
    |||||||||||||| |  |||  |||||||| ||||||||||||||||| ||||||||||||||||||||| ||| ||||||||| ||||||| ||| ||    
24526486 ttgaaatgtgtctcaaaattgaagttgaagtttggaaaaatcgtggcacgtttgcagggcaacgtggcacgattggatggttcaggttttgggtttgtca 24526387  T
127 ctggaaaatttgtggcacgatgcaggaggaacgtgg 162  Q
    |||||||| | |||||||||| ||||||||||||||    
24526386 ctggaaaaatcgtggcacgatccaggaggaacgtgg 24526351  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 50 - 154
Target Start/End: Original strand, 8152976 - 8153080
Alignment:
50 tgttgaagtctggaaaaatcgtggcacttttgcagggcaacgtggcacggttgaatggttcagcttttgggttgccactggaaaatttgtggcacgatgc 149  Q
    ||||||||| ||||||| ||||||||| ||||||||||||| ||||| | ||||||||||||  |||||||||| |||||||||| ||||||||||||||    
8152976 tgttgaagtttggaaaactcgtggcacgtttgcagggcaacatggcaggattgaatggttcaatttttgggttgacactggaaaaattgtggcacgatgc 8153075  T
150 aggag 154  Q
    |||||    
8153076 aggag 8153080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 53 - 156
Target Start/End: Original strand, 22269362 - 22269464
Alignment:
53 tgaagtctggaaaaatcgtggcacttttgcagggcaacgtggcacggttgaatggttcagcttttgggttgccactggaaaatttgtggcacgatgcagg 152  Q
    |||||||||||||||||||||||| ||||||||||||||||||||| ||  ||||||||   ||||||||| |||||||||| | |||||||||| ||||    
22269362 tgaagtctggaaaaatcgtggcacgtttgcagggcaacgtggcacgatttgatggttca-agtttgggttgtcactggaaaaatcgtggcacgatccagg 22269460  T
153 agga 156  Q
    ||||    
22269461 agga 22269464  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 26 - 106
Target Start/End: Complemental strand, 41318034 - 41317954
Alignment:
26 tgttgaaatgtgtctcgagtttggtgttgaagtctggaaaaatcgtggcacttttgcagggcaacgtggcacggttgaatg 106  Q
    |||||||||||||||| |  |||  |||||||| ||||||||||||||||| |||| |||||||||||||||| |||||||    
41318034 tgttgaaatgtgtctcaaaattgaagttgaagtttggaaaaatcgtggcacgtttgtagggcaacgtggcacgattgaatg 41317954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 89 - 154
Target Start/End: Complemental strand, 41317953 - 41317888
Alignment:
89 acgtggcacggttgaatggttcagcttttgggttgccactggaaaatttgtggcacgatgcaggag 154  Q
    |||||||||| |||||| |||||| ||||||||||||||| ||||| | |||||||||||||||||    
41317953 acgtggcacgattgaattgttcagtttttgggttgccactcgaaaaatcgtggcacgatgcaggag 41317888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 73; Significance: 3e-33; HSPs: 9)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 26 - 158
Target Start/End: Complemental strand, 28266157 - 28266025
Alignment:
26 tgttgaaatgtgtctcgagtttggtgttgaagtctggaaaaatcgtggcacttttgcagggcaacgtggcacggttgaatggttcagcttttgggttgcc 125  Q
    |||||||||||||||| |  ||| ||| ||||| || ||||||| |||||| ||||||||||||||||||||| ||||||||||||| ||||||||||||    
28266157 tgttgaaatgtgtctcaaaattgatgtggaagtttgaaaaaatcatggcacgtttgcagggcaacgtggcacgattgaatggttcagattttgggttgcc 28266058  T
126 actggaaaatttgtggcacgatgcaggaggaac 158  Q
    ||||||||| | |||||||||| || |||||||    
28266057 actggaaaaatcgtggcacgatccaagaggaac 28266025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 20 - 154
Target Start/End: Complemental strand, 50169765 - 50169630
Alignment:
20 gaaaactgttgaaatgtgtctcgagtttggtgttgaagtctggaaaaatcgtggcacttttgcagggcaacgtggcacggttgaatggttcag-cttttg 118  Q
    ||||| ||||||||||| |||  |  ||| ||||||||| | ||||||||||||||| |||||||||||||||| |||| |||||||||||||  |||||    
50169765 gaaaagtgttgaaatgtctcttaaaattgatgttgaagtttagaaaaatcgtggcacgtttgcagggcaacgtgacacgattgaatggttcagttttttg 50169666  T
119 ggttgccactggaaaatttgtggcacgatgcaggag 154  Q
    ||||||||||| |||| | |||||||||||||||||    
50169665 ggttgccactgtaaaaatcgtggcacgatgcaggag 50169630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 26 - 154
Target Start/End: Complemental strand, 50167737 - 50167608
Alignment:
26 tgttgaaatgtgtctcgagtttggtgttgaagtctggaaaaatcgtggcacttttgcagggcaacgtggcacggttgaatggttcag-cttttgggttgc 124  Q
    |||||||||||||||| |  ||  ||||||||| ||||||||||||||||| |||||||||||||||| ||   ||||||| |||||  |||||||||||    
50167737 tgttgaaatgtgtctcaaaattaatgttgaagtttggaaaaatcgtggcacgtttgcagggcaacgtgacataattgaatgattcagttttttgggttgc 50167638  T
125 cactggaaaatttgtggcacgatgcaggag 154  Q
    |||||||||| | |||||||||||||||||    
50167637 cactggaaaaatcgtggcacgatgcaggag 50167608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 53 - 156
Target Start/End: Complemental strand, 47256106 - 47256004
Alignment:
53 tgaagtctggaaaaatcgtggcacttttgcagggcaacgtggcacggttgaatggttcagcttttgggttgccactggaaaatttgtggcacgatgcagg 152  Q
    |||||||||||||||||||||||| ||||||| ||||||||||||| ||| |||||||||  |||| |||| |||||||||| | ||||||||||  |||    
47256106 tgaagtctggaaaaatcgtggcacgtttgcagtgcaacgtggcacgattggatggttcag-gtttgagttgtcactggaaaaatcgtggcacgatctagg 47256008  T
153 agga 156  Q
    ||||    
47256007 agga 47256004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 26 - 162
Target Start/End: Original strand, 776847 - 776981
Alignment:
26 tgttgaaatgtgtctcgagtttggtgttgaagtctggaaaaatcgtggcacttttgcagggcaacgtggcacggttgaatggttcagcttttgggttgcc 125  Q
    |||||||||||||||| |  |||  |||||||| ||||||||||||||||| |||| |||| ||| ||||||| ||||||||||||| |||| | |||||    
776847 tgttgaaatgtgtctcaaaattgaagttgaagtttggaaaaatcgtggcacgtttgtagggaaac-tggcacgattgaatggttcag-tttttgattgcc 776944  T
126 actggaaaatttgtggcacgatgcaggaggaacgtgg 162  Q
    | || |||| | |||||||||  ||||||||||||||    
776945 attgaaaaaatcgtggcacgacccaggaggaacgtgg 776981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 26 - 98
Target Start/End: Complemental strand, 8871666 - 8871594
Alignment:
26 tgttgaaatgtgtctcgagtttggtgttgaagtctggaaaaatcgtggcacttttgcagggcaacgtggcacg 98  Q
    |||||||||||||||| |  ||| ||||||||||||||||||||||||||| |||||||||||||||| ||||    
8871666 tgttgaaatgtgtctcaaaattgatgttgaagtctggaaaaatcgtggcacgtttgcagggcaacgtgacacg 8871594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 24 - 98
Target Start/End: Complemental strand, 45644900 - 45644826
Alignment:
24 actgttgaaatgtgtctcgagtttggtgttgaagtctggaaaaatcgtggcacttttgcagggcaacgtggcacg 98  Q
    |||||||||||||||||| |  |||  ||||||| |||||||||||||||||| |||||||||||||||||||||    
45644900 actgttgaaatgtgtctcaaaattgaagttgaagcctggaaaaatcgtggcacgtttgcagggcaacgtggcacg 45644826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 65 - 162
Target Start/End: Original strand, 47703428 - 47703525
Alignment:
65 aaatcgtggcacttttgcagggcaacgtggcacggttgaatggttcagcttttgggttgccactggaaaatttgtggcacgatgcaggaggaacgtgg 162  Q
    ||||||| |||| ||||||||||||||||||||| ||| ||||||||  ||| || ||| | |||||||||| || ||||||| ||| ||||||||||    
47703428 aaatcgtagcacatttgcagggcaacgtggcacgattggatggttcaaatttgggtttgtcgctggaaaattcgtagcacgatccagaaggaacgtgg 47703525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 62 - 162
Target Start/End: Original strand, 40816325 - 40816425
Alignment:
62 gaaaaatcgtggcacttttgcaggg-caacgtggcacggttgaatggttcagcttttgggttgccactggaaaatttgtggcacgatgcaggaggaacgt 160  Q
    ||||||||||||||  ||||||||| |||| ||| ||| ||| ||||||||| ||| || ||| || ||||||| | |||||||||| ||||||||||||    
40816325 gaaaaatcgtggcatgtttgcaggggcaacatggtacgattggatggttcaggttt-ggtttgtcattggaaaaatcgtggcacgatccaggaggaacgt 40816423  T
161 gg 162  Q
    ||    
40816424 gg 40816425  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 59; Significance: 6e-25; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 25 - 162
Target Start/End: Complemental strand, 3039506 - 3039368
Alignment:
25 ctgttgaaatgtgtctcgagtttggtgttgaagtctggaaaaatcgtggcacttttgcagggcaacgtggcacggttgaatggttcagcttttggg-ttg 123  Q
    ||||||||||||||||| |  ||  ||||||||| ||| ||||||||||||| ||||||||||||||||||||| ||| ||||||||| ||||||| |||    
3039506 ctgttgaaatgtgtctcaaaatttatgttgaagtttgggaaaatcgtggcacgtttgcagggcaacgtggcacgattggatggttcagattttgggtttg 3039407  T
124 ccactggaaaatttgtggcacgatgcaggaggaacgtgg 162  Q
     | |||||||| | ||||||  || ||||||||||||||    
3039406 tcgctggaaaaatcgtggcaaaatccaggaggaacgtgg 3039368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 62 - 158
Target Start/End: Original strand, 21800909 - 21801005
Alignment:
62 gaaaaatcgtggcacttttgcagggcaacgtggcacggttgaatggttcagcttttgggttgccactggaaaatttgtggcacgatgcaggaggaac 158  Q
    ||||||||||||||| ||||||||||||||||| ||| ||| ||||||||| ||| || ||| |||||||||| | |||||||||| || |||||||    
21800909 gaaaaatcgtggcacgtttgcagggcaacgtggtacgattggatggttcaggtttgggtttgtcactggaaaaatcgtggcacgatccaagaggaac 21801005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 56; Significance: 4e-23; HSPs: 4)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 53 - 156
Target Start/End: Original strand, 28277722 - 28277824
Alignment:
53 tgaagtctggaaaaatcgtggcacttttgcagggcaacgtggcacggttgaatggttcagcttttgggttgccactggaaaatttgtggcacgatgcagg 152  Q
    |||||||| ||||||||||||||| ||||||||||||||||||||| ||| |||||| ||  ||||||||| || ||||||| |||||||||||| ||||    
28277722 tgaagtctagaaaaatcgtggcacgtttgcagggcaacgtggcacgattggatggtttag-gtttgggttgtcattggaaaaattgtggcacgatccagg 28277820  T
153 agga 156  Q
    ||||    
28277821 agga 28277824  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 65 - 162
Target Start/End: Complemental strand, 10282316 - 10282218
Alignment:
65 aaatcgtggcacttttgcagggcaacgtggcacggttgaatggttcagcttttggg-ttgccactggaaaatttgtggcacgatgcaggaggaacgtgg 162  Q
    |||||||||||| ||||||||||||||||||||| ||| ||||||||| ||||||| ||| | |||||||| | |||||||||| ||||||||||||||    
10282316 aaatcgtggcacgtttgcagggcaacgtggcacgattggatggttcaggttttgggtttgtcgctggaaaaatcgtggcacgatccaggaggaacgtgg 10282218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 65 - 162
Target Start/End: Complemental strand, 3881338 - 3881240
Alignment:
65 aaatcgtggcacttttgcagggcaacgtggcacggttgaatggttcagcttttggg-ttgccactggaaaatttgtggcacgatgcaggaggaacgtgg 162  Q
    |||||||||||| ||||||||||||||||||||| ||| ||||||||| ||||||| ||  |  ||||||| | |||||||||| ||||||||||||||    
3881338 aaatcgtggcacgtttgcagggcaacgtggcacgattggatggttcaggttttgggtttatcgttggaaaaatcgtggcacgatccaggaggaacgtgg 3881240  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 58 - 145
Target Start/End: Complemental strand, 16642629 - 16642543
Alignment:
58 tctggaaaaatcgtggcacttttgcagggcaacgtggcacggttgaatggttcagcttttgggttgccactggaaaatttgtggcacg 145  Q
    ||||||||||||||||||| ||||||| ||||||||||||| ||| |||||| |   | ||||||||||||||||||  |||||||||    
16642629 tctggaaaaatcgtggcacgtttgcagagcaacgtggcacgattggatggttta-agtctgggttgccactggaaaaaatgtggcacg 16642543  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0148 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: scaffold0148
Description:

Target: scaffold0148; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 65 - 162
Target Start/End: Complemental strand, 11335 - 11238
Alignment:
65 aaatcgtggcacttttgcagggcaacgtggcacggttgaatggttcagcttttgggttgccactggaaaatttgtggcacgatgcaggaggaacgtgg 162  Q
    |||||||||||| ||||||||||||||||||||| ||  |||||||||  ||  | |||   || ||||||||||||||||||  || ||||||||||    
11335 aaatcgtggcacgtttgcagggcaacgtggcacgattagatggttcagaattgagtttgttgctcgaaaatttgtggcacgatttagaaggaacgtgg 11238  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0477 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: scaffold0477
Description:

Target: scaffold0477; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 65 - 162
Target Start/End: Original strand, 5446 - 5545
Alignment:
65 aaatcgtggcacttttgcagggcaacgtggcacggttgaatggttcagcttttggg-ttgccactgg-aaaatttgtggcacgatgcaggaggaacgtgg 162  Q
    ||||| || ||| ||||||||||||||||||||| ||  ||||||||| ||||||| ||| | |||| |||||  |||||||||||||| | ||||||||    
5446 aaatcatgacacgtttgcagggcaacgtggcacgattagatggttcagattttgggtttgtcgctggaaaaatacgtggcacgatgcagaaagaacgtgg 5545  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University