View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21486_high_12 (Length: 206)
Name: NF21486_high_12
Description: NF21486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21486_high_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 129; Significance: 6e-67; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 40 - 188
Target Start/End: Complemental strand, 39954303 - 39954155
Alignment:
| Q |
40 |
gaattctatagcaaacatgattaggactcatcaatccaagtgtccacatgtatgtgagcaacatgaatgtgacagcaattatcattaaaactgttaaaat |
139 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
39954303 |
gaattctatagcaaacatgattaggactaatcaatccaagtgcccacatgtatgtgagcaacatgaatgtgacagcaattatcattaaatctgttaaaat |
39954204 |
T |
 |
| Q |
140 |
ccccatcatggccttattcccaagtggtaatccactgatgagaaccaac |
188 |
Q |
| |
|
|||||||| |||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
39954203 |
ccccatcacggccttattcccaagtggaaatccactgatgagaaccaac |
39954155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 16 - 46
Target Start/End: Complemental strand, 39954417 - 39954387
Alignment:
| Q |
16 |
aatatacaatcatactgattaggagaattct |
46 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
39954417 |
aatatacaatcatactgattaggagaattct |
39954387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University