View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21486_low_13 (Length: 241)
Name: NF21486_low_13
Description: NF21486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21486_low_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 91 - 191
Target Start/End: Original strand, 43953277 - 43953377
Alignment:
| Q |
91 |
gtcaaataagacaacaaaatttctccgaggagcagcataataatggaggacattcatggttactcttgcacatgttgaaaccttgattaagttaagcatt |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
43953277 |
gtcaaataagacaacaaaatttctccgaggagcagcataataatggaggacactcatggttactcatgcacatgttgaaaccttgattaagttaagcatt |
43953376 |
T |
|
| Q |
191 |
g |
191 |
Q |
| |
|
| |
|
|
| T |
43953377 |
g |
43953377 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 13 - 91
Target Start/End: Original strand, 43953156 - 43953234
Alignment:
| Q |
13 |
tcgaagaaaatgtaacaaatgtttatttggcggtgtcacaatcattgatgttgcatcccatggcatagaaataaattag |
91 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43953156 |
tcgaacaaaatgtaacaaatgtttatttggcggtgtcacaatcattgatgttgcatcccatggcatagaaataaattag |
43953234 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University