View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21486_low_14 (Length: 206)

Name: NF21486_low_14
Description: NF21486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21486_low_14
NF21486_low_14
[»] chr7 (2 HSPs)
chr7 (40-188)||(39954155-39954303)
chr7 (16-46)||(39954387-39954417)


Alignment Details
Target: chr7 (Bit Score: 129; Significance: 6e-67; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 40 - 188
Target Start/End: Complemental strand, 39954303 - 39954155
Alignment:
40 gaattctatagcaaacatgattaggactcatcaatccaagtgtccacatgtatgtgagcaacatgaatgtgacagcaattatcattaaaactgttaaaat 139  Q
    |||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
39954303 gaattctatagcaaacatgattaggactaatcaatccaagtgcccacatgtatgtgagcaacatgaatgtgacagcaattatcattaaatctgttaaaat 39954204  T
140 ccccatcatggccttattcccaagtggtaatccactgatgagaaccaac 188  Q
    |||||||| |||||||||||||||||| |||||||||||||||||||||    
39954203 ccccatcacggccttattcccaagtggaaatccactgatgagaaccaac 39954155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 16 - 46
Target Start/End: Complemental strand, 39954417 - 39954387
Alignment:
16 aatatacaatcatactgattaggagaattct 46  Q
    |||||||||||||||||||||||||||||||    
39954417 aatatacaatcatactgattaggagaattct 39954387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University