View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21486_low_3 (Length: 554)
Name: NF21486_low_3
Description: NF21486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21486_low_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 292; Significance: 1e-164; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 292; E-Value: 1e-164
Query Start/End: Original strand, 196 - 538
Target Start/End: Complemental strand, 7742465 - 7742126
Alignment:
| Q |
196 |
gcttatttccaccgccgccgcctctttcatcctcttcatcttcatcttcatgcattcgtcgacgacgactcatcgctgcaaaccctagattgaattttaa |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7742465 |
gcttatttccaccgccgccgcctctttcatcctcttcatcttcat------gcattcgtcgacgacgactcatcgctgcaaaccctagattgaattttaa |
7742372 |
T |
 |
| Q |
296 |
cgaattttgtttttgttggaagctttacgattggaattggaatatggaagctttacgattggaattttgttcttgaaacgagggtgaaggagaatggtag |
395 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7742371 |
cgaattttgtttttgttggaagctttacgattggaattggaatatggaagctttacgattggaattttgttcttgaaacgagggtgaaggagaatggtag |
7742272 |
T |
 |
| Q |
396 |
tggagagtgatcgagagattgaggaagaatagatatagattggaggttaagagttggaatttaaacactctcacttgaaattcttgcatgcaaatgcacc |
495 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7742271 |
tggagagtgatcgagagattgaggaagaatagatatagattggaggttaagagttggaatttaaacactctcacttgaaattcttgcatgcaaatgcacc |
7742172 |
T |
 |
| Q |
496 |
taa-atataaagtttt--acacacatcatttatttatgttataaat |
538 |
Q |
| |
|
||| ||||| ||||| |||||||||||| ||||||||||||||| |
|
|
| T |
7742171 |
taacgtataaggttttacacacacatcattaatttatgttataaat |
7742126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 12 - 64
Target Start/End: Complemental strand, 40863671 - 40863619
Alignment:
| Q |
12 |
tcatcagaatcaacatcagcctcttcatcaaagaaattcaaagcagaaacctt |
64 |
Q |
| |
|
||||| ||||||||| |||||||||| ||||||||||| |||| |||||||| |
|
|
| T |
40863671 |
tcatccgaatcaacagcagcctcttcgtcaaagaaatttgaagcggaaacctt |
40863619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University