View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21488_low_6 (Length: 301)
Name: NF21488_low_6
Description: NF21488
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21488_low_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 285
Target Start/End: Complemental strand, 36728422 - 36728132
Alignment:
| Q |
1 |
tggcagataacatgtttctatggttaccaagaagg-cgtgattcttggaatttgttgcatcagctagaaaacgaatcaagcctaccatgatgtattattg |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
36728422 |
tggcagataacatgtttctatggttaccaagaaggacgtgattcttggaatttgttgcatcagctagaaaatgaatcaagcctaccatgatgtattattg |
36728323 |
T |
 |
| Q |
100 |
gtggtttcaatgatattctttcttttgatgaaaaaagaggcaggacggatagatcaaaataagctcatcaa---tggtttccgtgaggcattaacaaatg |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||| |||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
36728322 |
gtggtttcaatgatattctttcttttgatgaaaaaaggggcagggcggatagatc-aaataagctcatcaatattggtttccgtgaggcattaacaaatg |
36728224 |
T |
 |
| Q |
197 |
cgggtttgattg---atttgaatatggaggggtaactcgaccatacaatgactataaacaactggtgtagtatgttttcagagtgcttaact |
285 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36728223 |
tgggtttgattgattatttgaatatggaggggtaactcgaccatacaatgactataaacaactggtgtagtatgttttcagagtgcttaact |
36728132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University