View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21488_low_7 (Length: 290)
Name: NF21488_low_7
Description: NF21488
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21488_low_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 25686233 - 25686472
Alignment:
| Q |
1 |
tggagatacttaaatgaattagacctatatgcgtgtacatatgtccatcatatgtacaatttaccaaaaatacatacaaggtcatggaccacactccctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
25686233 |
tggagatacttaaatgaattagacctatatgcgtgtacatatgtccatcatatgtacaatttacaaaaaatacatacaaggtcatggaccacactccctt |
25686332 |
T |
|
| Q |
101 |
ggctatgttaatttctcataatttcatcaatgacaacccctagctcgatctgaagcataagaataaagtgattgggaagtaaattaaaaatagtaagtat |
200 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25686333 |
ggctatgttaatttctcataaattcatcaatgacaacccctagctcgatctgaagcataagaataaagtgattgggaagtaaattaaaaatagtaagtat |
25686432 |
T |
|
| Q |
201 |
gtaccttgttacctaactagaaaggttgaaattattaggg |
240 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
25686433 |
gtaccttgttacctaactaaaaaggttgaaattattaggg |
25686472 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University