View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21488_low_8 (Length: 289)
Name: NF21488_low_8
Description: NF21488
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21488_low_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 38 - 117
Target Start/End: Original strand, 31397031 - 31397110
Alignment:
| Q |
38 |
aaaagcaagtaggctcgaagagcaacaatcatcttaattaagttggtatcactgaaccaaactaaaaaaccacgagcaaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31397031 |
aaaagcaagtaggctcgaagagcaacaatcatcttaattaagttggtatcactgaaccaaactaaaaaaccacgagcaaa |
31397110 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 200 - 276
Target Start/End: Original strand, 31397115 - 31397191
Alignment:
| Q |
200 |
attttggtctctcgctcatatttttgaattaataagttggtaatgtaatatatgttgtggtatatgatatgatgatg |
276 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
31397115 |
atttaggtttctcgctcatatttttgaattaataagttggtaatgtaatatatgttgtggtatataatatgatgatg |
31397191 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University