View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21489_low_4 (Length: 307)
Name: NF21489_low_4
Description: NF21489
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21489_low_4 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 22 - 307
Target Start/End: Complemental strand, 37717056 - 37716767
Alignment:
| Q |
22 |
tgaccaagtttgtggatgatggttcacattgataatgatggagcttcctggacaataaaagacgaaattttaacatacactcttctactatatgttatag |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37717056 |
tgaccaagtttgtggatgatggttcacattgataatgatggagcttcctggacaataaaagacgaaattttaacatacactcttctactatatgttatag |
37716957 |
T |
 |
| Q |
122 |
ctattgatgcattttgatgttaggatgatacaatacatcatggagatattggtcaca---cttactannnnnnnnnngcaaagaatcacacttttcttag |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
37716956 |
ctattgatgcattttgatgttaggatgatacaatacatcatggagatattggtcacacttcttactttttttttttggcaaagaatcacacttttcttag |
37716857 |
T |
 |
| Q |
219 |
tctttttgtaaaatgctggtctaggatttctaatagttatctttgacacttggtttcctaagcaattttgtttgaatc-agccatacttc |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
37716856 |
tctttttgtaaaatgctggtctaggatttctaatagttatctttgacacttggtttcctaagcaattttgtttgaatcaagccatacttc |
37716767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University