View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2148_high_9 (Length: 237)
Name: NF2148_high_9
Description: NF2148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2148_high_9 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 139 - 237
Target Start/End: Original strand, 2906445 - 2906543
Alignment:
| Q |
139 |
ttaatatgctaaactagtctctttttcttggtctttgaaattaaatacaggttttttgtagttgctagtgctattgtgagtggctacctgattctttct |
237 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2906445 |
ttaatatgctaaactaatctctttttcttggtctttgaaattaaatacaggttttttgtagttgctagtgctattgtgagtggctacctgattctttct |
2906543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University