View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2148_high_9 (Length: 237)

Name: NF2148_high_9
Description: NF2148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2148_high_9
NF2148_high_9
[»] chr7 (1 HSPs)
chr7 (139-237)||(2906445-2906543)


Alignment Details
Target: chr7 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 139 - 237
Target Start/End: Original strand, 2906445 - 2906543
Alignment:
139 ttaatatgctaaactagtctctttttcttggtctttgaaattaaatacaggttttttgtagttgctagtgctattgtgagtggctacctgattctttct 237  Q
    |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2906445 ttaatatgctaaactaatctctttttcttggtctttgaaattaaatacaggttttttgtagttgctagtgctattgtgagtggctacctgattctttct 2906543  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University