View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21492_low_1 (Length: 241)
Name: NF21492_low_1
Description: NF21492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21492_low_1 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 165; Significance: 2e-88; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 18 - 190
Target Start/End: Complemental strand, 33513727 - 33513555
Alignment:
| Q |
18 |
agttggtcgatgaggtgacggaattcggggaggttgtagtggaaacggaaggagtcggaggtggggatggattggagggaggcagagagggcagagaggt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
33513727 |
agttggtcgatgaggtgacggaattcggggaggttgtagtggaaacggaaggagtcggaggtggggatggattggagggaggcggagagggcggagaggt |
33513628 |
T |
|
| Q |
118 |
ggtggttgaaatcttccattgaaaggggtttagggttagggtttttggggatttggtgaaggggatgaaatgg |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33513627 |
ggtggttgaaatcttccattgaaaggggtttagggttagggtttttggggatttggtgaaggggatgaaatgg |
33513555 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 26 - 190
Target Start/End: Complemental strand, 34121195 - 34121033
Alignment:
| Q |
26 |
gatgaggtgacggaattcggggaggttgtagtggaaacggaaggagtcggaggtggggatggattggagggaggcagagagggcagagaggtggtggttg |
125 |
Q |
| |
|
|||||| ||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
34121195 |
gatgagatgacggaattcggggaggtagtagtggaaacggaatgagtcggaggtggggatggattggagggagg--tagagggcggagaggtggtggttg |
34121098 |
T |
|
| Q |
126 |
aaatcttccattgaaaggggtttagggttagggtttttggggatttggtgaaggggatgaaatgg |
190 |
Q |
| |
|
|| |||||||||| | ||| || |||||||||||||||||| |||||| ||| ||| |||||||| |
|
|
| T |
34121097 |
aagtcttccattggaggggtttaagggttagggtttttgggaatttggcgaacggggtgaaatgg |
34121033 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University