View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21493_high_14 (Length: 423)

Name: NF21493_high_14
Description: NF21493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21493_high_14
NF21493_high_14
[»] chr8 (1 HSPs)
chr8 (315-406)||(10714864-10714955)


Alignment Details
Target: chr8 (Bit Score: 92; Significance: 1e-44; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 315 - 406
Target Start/End: Complemental strand, 10714955 - 10714864
Alignment:
315 ctatgattctccagcagcaatctttgaggaggagtgaattgtggatacaccaattcttgtccatggaaatctctgacttccaacacaaaaag 406  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10714955 ctatgattctccagcagcaatctttgaggaggagtgaattgtggatacaccaattcttgtccatggaaatctctgacttccaacacaaaaag 10714864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University