View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21493_high_20 (Length: 351)
Name: NF21493_high_20
Description: NF21493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21493_high_20 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 282; Significance: 1e-158; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 1 - 310
Target Start/End: Complemental strand, 22460845 - 22460536
Alignment:
| Q |
1 |
aagaaataaaacataaaataaaattggcatttagagttaaacctcaaaaatccgttacaaagtaccctctcaatatagtttgatcataggtgtttaccct |
100 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
22460845 |
aagaaataaaacataaaacaaaattggcatttagagttaaacctcaaaaatccgttacaaagtaccctctcaacatagtttgatcataggtgtttaccct |
22460746 |
T |
 |
| Q |
101 |
tccattacaaaggatggtcatatttgaattcggtaaaatggcggctccaagatccttccggctcaaacaaacaaccttatttatactgctcaaatatgaa |
200 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22460745 |
tccattacaaaggattgtcatatttgaattcggtaaaatggcggctccaagatccttccggctcaaacaaacaaccttatttatactgctcaaatatgaa |
22460646 |
T |
 |
| Q |
201 |
aacctaattttgaatttgtatgaacaagagttggcccaataggcactaatcggcccattgcaacaaaagatcaagtggcctaaactcatatttaacttca |
300 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
22460645 |
aacctaatttcgaatttgtatgaacaagagttggcccaataggcgttaatcggcccattgcaataaaagatcaagtggcctaaactcatatttaacttca |
22460546 |
T |
 |
| Q |
301 |
atcctctaga |
310 |
Q |
| |
|
|||||||||| |
|
|
| T |
22460545 |
atcctctaga |
22460536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University