View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21493_high_23 (Length: 295)
Name: NF21493_high_23
Description: NF21493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21493_high_23 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 92; Significance: 1e-44; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 161 - 279
Target Start/End: Original strand, 18291339 - 18291464
Alignment:
| Q |
161 |
ttctacatggttttatgaccattcttgtcttatccattgctcttttgggtttgtcacgagt-------acccccactcacactctcccttggaatccatg |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
18291339 |
ttctacatggttttatgaccattcttgtcttatccattgctcttttgggtttgtcatgagtacccccaacccccactcacactctcccttggaatccatg |
18291438 |
T |
 |
| Q |
254 |
tattacacattcattgtgtaccattt |
279 |
Q |
| |
|
||||||||||||||||||| |||||| |
|
|
| T |
18291439 |
tattacacattcattgtgtgccattt |
18291464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 27 - 164
Target Start/End: Original strand, 18291143 - 18291278
Alignment:
| Q |
27 |
taaaatccgaaccaaattcagagatatttttaaaataactatacacacacatgagtttacgtacannnnnnnnnnaaattcagatgatcatgagtttact |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
18291143 |
taaaatccgaaccaaattcagagatatttttaaaataactatacacacacatgagtttacgtaca--tttttttaaagttcagatgatcatgagtttact |
18291240 |
T |
 |
| Q |
127 |
tatgtgtggtgttacttccttctaacttcttttcttct |
164 |
Q |
| |
|
|||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
18291241 |
tatgtgtgttgttacttccttctaatttcttttcttct |
18291278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University