View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21493_high_28 (Length: 225)
Name: NF21493_high_28
Description: NF21493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21493_high_28 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 11 - 208
Target Start/End: Original strand, 44779426 - 44779622
Alignment:
| Q |
11 |
aagcaaaggtgatgcaaagaaattttctcaacaattgttgaaagcaaaaaataccattgcaaaattattagtgtcatttgtgtgatgccgaatgcgaaag |
110 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
44779426 |
aagcataggtgatgcaaagaaattttctcaacaattgttgaaagcaaaaaataccattgcaaaattattagtgtcatttgtgtgatgccgaatacgaaag |
44779525 |
T |
 |
| Q |
111 |
aatgaaacagataacggtgtttatggtaagttaaaaaatcaaataaaagggattgtgttaaatttctcaaaaattggtggggaacataagtgagggtt |
208 |
Q |
| |
|
||| ||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
44779526 |
aattaaacatataacggtgtttatggt-agttaaaaaatcaaataaaagggattgtgttaaatttctcaaaaattggtgggggacataagtgagggtt |
44779622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University