View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21493_low_10 (Length: 454)
Name: NF21493_low_10
Description: NF21493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21493_low_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 204; Significance: 1e-111; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 14 - 225
Target Start/End: Original strand, 48754555 - 48754766
Alignment:
| Q |
14 |
ttctagccgtacaaatttgagagctgcaggatttcagctgggactgacgagattttgactcgatttcattttgtatttgtttattgtggtgtgttatctc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||| |
|
|
| T |
48754555 |
ttctagccgtacaaatttgagagctgcaggatttcagctgggactgacgagattttgactcgatttcattttttatttgtttattgtggtgtgttgtctc |
48754654 |
T |
|
| Q |
114 |
tctgattgtggttacaaattagaacagttaattgtctgaagctcaatatggggatcaaagccctgaaacaccttgaatgactcagaaaaggccatttaag |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48754655 |
tctgattgtggttacaaattagaacagttaattgtctgaagctcaatatggggatcaaagccctgaaacaccttgaatgactcagaaaaggccatttaag |
48754754 |
T |
|
| Q |
214 |
aggttgcctctg |
225 |
Q |
| |
|
|||||||||||| |
|
|
| T |
48754755 |
aggttgcctctg |
48754766 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 121; E-Value: 8e-62
Query Start/End: Original strand, 296 - 436
Target Start/End: Original strand, 48754837 - 48754977
Alignment:
| Q |
296 |
aatcatgttattgttcggattattatgcaaaacttgttatttactaattttgaatgggttttactgttgctctggattttggaccatacttttgttacta |
395 |
Q |
| |
|
|||||||||||| |||||||||||||||||| ||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
48754837 |
aatcatgttatttttcggattattatgcaaacctttttatttactaattttgaatgggttttaccgttgctctggattttggaccatacttttgttacta |
48754936 |
T |
|
| Q |
396 |
tttttggagtcttttagtttttaatgtggctatggattgtg |
436 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
48754937 |
tttttggagtcttttagtttttaatgtgactatggattgtg |
48754977 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University