View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21494_high_4 (Length: 242)
Name: NF21494_high_4
Description: NF21494
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21494_high_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 19 - 193
Target Start/End: Complemental strand, 5198046 - 5197872
Alignment:
| Q |
19 |
tattaatgttgctctttatttttgtcactaaagttacttttctcttacnnnnnnnnnctataccctagggtttaagtgagttacatttgaaaagtcaaat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5198046 |
tattaatgttgctctttatttttgtcactaaagttacttttctcttacaaaaaaaaactataccctagggtttaagtgagttacatttgaaaagtcaaat |
5197947 |
T |
 |
| Q |
119 |
agatttgactctttagtaagtatgaaatccgaatttgacagtgcaaaacctagaggttaatattttgtatttttt |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||| |
|
|
| T |
5197946 |
agatttgactctttagtaagtatgaaatccgaatttgacagtgcaaaatctagaggttaatatttagtatttttt |
5197872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 184 - 212
Target Start/End: Complemental strand, 5197848 - 5197820
Alignment:
| Q |
184 |
tgtattttttgtgatatgaaacaaatttt |
212 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
5197848 |
tgtattttttgtgatatgaaacaaatttt |
5197820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University