View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21494_low_5 (Length: 242)

Name: NF21494_low_5
Description: NF21494
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21494_low_5
NF21494_low_5
[»] chr1 (2 HSPs)
chr1 (19-193)||(5197872-5198046)
chr1 (184-212)||(5197820-5197848)


Alignment Details
Target: chr1 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 19 - 193
Target Start/End: Complemental strand, 5198046 - 5197872
Alignment:
19 tattaatgttgctctttatttttgtcactaaagttacttttctcttacnnnnnnnnnctataccctagggtttaagtgagttacatttgaaaagtcaaat 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||         |||||||||||||||||||||||||||||||||||||||||||    
5198046 tattaatgttgctctttatttttgtcactaaagttacttttctcttacaaaaaaaaactataccctagggtttaagtgagttacatttgaaaagtcaaat 5197947  T
119 agatttgactctttagtaagtatgaaatccgaatttgacagtgcaaaacctagaggttaatattttgtatttttt 193  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||    
5197946 agatttgactctttagtaagtatgaaatccgaatttgacagtgcaaaatctagaggttaatatttagtatttttt 5197872  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 184 - 212
Target Start/End: Complemental strand, 5197848 - 5197820
Alignment:
184 tgtattttttgtgatatgaaacaaatttt 212  Q
    |||||||||||||||||||||||||||||    
5197848 tgtattttttgtgatatgaaacaaatttt 5197820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University