View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21497_high_4 (Length: 393)
Name: NF21497_high_4
Description: NF21497
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21497_high_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 349; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 349; E-Value: 0
Query Start/End: Original strand, 27 - 375
Target Start/End: Original strand, 7296580 - 7296928
Alignment:
| Q |
27 |
ggtcttttatctttatgtccatagcaatttacattgtaacctctcttttactccaccttttattatctatctttctttgccataccaaacatattcctct |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7296580 |
ggtcttttatctttatgtccatagcaatttacattgtaacctctcttttactccaccttttattatctatctttctttgccataccaaacatattcctct |
7296679 |
T |
 |
| Q |
127 |
tggccctttacctgcacttcattctctcaccgtgtccatcgtatccaccatcatattccttggaatattactctccaccgtctctgaaatcaaagaaaca |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7296680 |
tggccctttacctgcacttcattctctcaccgtgtccatcgtatccaccatcatattccttggaatattactctccaccgtctctgaaatcaaagaaaca |
7296779 |
T |
 |
| Q |
227 |
cgatggttttggcgtcgatcaaaaacccctcttcaatggctactttgttttcctcttggcactcgcccttcaggccgtgttttcttttggtcttatattt |
326 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7296780 |
cgatggttttggcgtcgatcaaaaacccctcttcaatggctactttgttttcctcttggcactcgcccttcaggccgtgttttcttttggtcttatattt |
7296879 |
T |
 |
| Q |
327 |
tctacctatctcgtttccttcatatgtttataacttttttcgccattct |
375 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7296880 |
tctacctatctcgtttccttcatatgtttataacttttttcgccattct |
7296928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University