View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21497_high_5 (Length: 354)
Name: NF21497_high_5
Description: NF21497
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21497_high_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 202; Significance: 1e-110; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 123 - 348
Target Start/End: Complemental strand, 38516371 - 38516147
Alignment:
| Q |
123 |
gattatgattattttggaagagatgaaagaaacgcgtttgttaaataggagaattggaaatgatgaaaataagggttttgatggcgggaataagcaagct |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
38516371 |
gattatgattattttggaagagatgaaagaaacgcgtttgttaaataggagaattggaaatgatgaaaagaagggttt-gatggcgggaataagcaagct |
38516273 |
T |
|
| Q |
223 |
gtttggcgggataagttgccgcttggaactgctgtgaaaattttgtagcttttttggtttcggcttgggtttttattaaattgattacgggttatatgag |
322 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38516272 |
gtttggcgggataagttgccgcttggaactgctgtgaaaattttgtagcttttttggtttgggcttgggtttttattaaattgattacgggttatatgag |
38516173 |
T |
|
| Q |
323 |
ggttagctacacactacctttgctac |
348 |
Q |
| |
|
|||||||||||||||| |||||||| |
|
|
| T |
38516172 |
tgttagctacacactacttttgctac |
38516147 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 19 - 73
Target Start/End: Complemental strand, 38516470 - 38516416
Alignment:
| Q |
19 |
tgaaccgtagaatttggatggttttagagaaacaaccattttggaagcgattttg |
73 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38516470 |
tgaaccgtagaatttggatggttttagagaaacaaccattttggaagcgattttg |
38516416 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University