View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21497_low_12 (Length: 212)

Name: NF21497_low_12
Description: NF21497
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21497_low_12
NF21497_low_12
[»] chr3 (1 HSPs)
chr3 (48-193)||(48320156-48320301)


Alignment Details
Target: chr3 (Bit Score: 134; Significance: 6e-70; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 48 - 193
Target Start/End: Complemental strand, 48320301 - 48320156
Alignment:
48 taataatgatccatttgcttacaatttagaatcaccagaaaatgatcatcatagtcaacaagtgcatggtggttgtgatgatccttatatgtacaattta 147  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||    
48320301 taataatgatccatttgcttacaatttagaatcaccagaaaatgatcatcatattcaacaagtgcatggtggttgtaatgatccttatatgtacaattta 48320202  T
148 gtaacaccagaaaatcaccatgaatatattcaacaagggcagggtg 193  Q
    ||| ||||||||||||||||||||||||||||||||||||||||||    
48320201 gtaccaccagaaaatcaccatgaatatattcaacaagggcagggtg 48320156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University