View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21497_low_12 (Length: 212)
Name: NF21497_low_12
Description: NF21497
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21497_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 134; Significance: 6e-70; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 48 - 193
Target Start/End: Complemental strand, 48320301 - 48320156
Alignment:
| Q |
48 |
taataatgatccatttgcttacaatttagaatcaccagaaaatgatcatcatagtcaacaagtgcatggtggttgtgatgatccttatatgtacaattta |
147 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
48320301 |
taataatgatccatttgcttacaatttagaatcaccagaaaatgatcatcatattcaacaagtgcatggtggttgtaatgatccttatatgtacaattta |
48320202 |
T |
 |
| Q |
148 |
gtaacaccagaaaatcaccatgaatatattcaacaagggcagggtg |
193 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48320201 |
gtaccaccagaaaatcaccatgaatatattcaacaagggcagggtg |
48320156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University