View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21499_high_6 (Length: 226)
Name: NF21499_high_6
Description: NF21499
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21499_high_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 1 - 212
Target Start/End: Original strand, 53929797 - 53930008
Alignment:
| Q |
1 |
ccttgatggttgattgctcatggcatagaagttggcttgaggacaccttaaaaacacctccaacccaaaatttacaagttcttccttcgccatatatatc |
100 |
Q |
| |
|
|||||||||||| | | |||||||||||||||||||||||||||||||||||| ||||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
53929797 |
ccttgatggttgctcgttcatggcatagaagttggcttgaggacaccttaaaagaacctccagccgaaaatttacaagttcttccttcgccatatatatc |
53929896 |
T |
 |
| Q |
101 |
tcttccacttatgagcattgtcaaaattgctaggtatgtctctttcagagccttcctctcaaaattcaaccaatttcttcctaacaatcaataacctttc |
200 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
53929897 |
tcttccacttatgagcattgtaaaaattgctaggtatgtgtctttcagagccatcctctcaaaattcaaccaatttcttcataacaatcaataacctttc |
53929996 |
T |
 |
| Q |
201 |
aagattgatatt |
212 |
Q |
| |
|
|||||||||||| |
|
|
| T |
53929997 |
aagattgatatt |
53930008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University